Minor II Answer Keys: For any clarifications, please seek an appointment with Prof. B. Jayaram

Set A

S. No.

(Marks)

Question

Answer

1

(1)

Human genome is made up of

(a) coding, noncoding and extragenic DNA.

(b) genes for mRNA, tRNA, rRNA, micro RNA.

(c) genes for proteins, lipids and carbohydrates.

(d) genes for all types of RNA and telomeres. 

A

2

(1)

Tuberculosis is caused by a pathogen which belongs to

(a) eukaryotes.

(b) prokaryotes.

(c) archaea.

(d) fungi.

B

3

(1)

Membrane bilayer formation from monolayers is spontaneous in aqueous solutions and is facilitated primarily by 

(a) hydrogen bonds + hydrophobicity.

(b) van der Waals interactions + hydrophobicity.

(c) electrostatic + van der Waals interactions

(d) covalent bonds + hydrogen bonds

B

4

(1)

Simply stated, the difference between proteins bound in membranes and molecules in liquid crystals is that

(a) the former translate and rotate, the latter do not

(b) the former vibrate and the latter do not

(c) the former translate, the latter rotate

(d) the former rotate and the latter translate

C

5

(1)

Penicillin is not the best treatment for  viral infections because

(a) viruses developed b-lactamase to destroy penicillins.

(b) some humans develop allergic reaction to penicillin.

(c) viruses lack cellulose.

(d) viruses lack peptidoglycans.

D

6

(1)

Designing antibodies to fight/recognize antigens  is an example of

(a) protein folding problem.

(b) translation.

(c) inverse protein folding problem.

(d) replication.

C

7

(1)

Alternative splicing requires

(a) stem cells.

(b) ribosomes.

(c) meiosis.

(d) introns and exons.

D

8

(2)

Suppose you wish to remove 5’ ΰ 3’ directionality in DNA by making it symmetric. You could do this by creating an additional  covalent bond or by cleaving an existing covalent bond.

(a) create  a bond between C3’ and C5’ or cleave the bond between C4’ and O

 (b) create a bond between C2’ and C5’ or cleave the bond between C2’ and C3’

 (c) create a bond between C2’ and C4’ or cleave the bond between C3’ and C5’

(d) create a bond between C1’ and C3’ or cleave the bond between C1’ and C2’

B

9

(2)

How many ORFs are there in a piece of double helical DNA represented in the 5’ to 3’ direction as TTAATGCATGACTTAATATAA

(a)  0

(b)  1

(c)  2

(d)  3

D

10

(2)

How many matches are found in the best possible alignment of the following two sequences:  DLQDRYFQ & DNYYQALQ

(a) 2

(b) 3

(c) 4

(d) 5

B

11

(1)

What is reduced in Anfinsen’s experiments?

(a) Main chain carbonyl groups

(b) Side chain carbonyl groups

(c) S-S bonds between cysteines

(d) S-S bonds between methionines

C

12

(1)

Humans can digest starch easily but not cellulose, although both contain glucose because of 

(a) a (1-4) bonds in the former and b (1-4) bonds in the latter.

(b) a (1-6) bonds in the former and b (1-6) bonds in the latter.

(c) b (1-4) bonds in the former and a (1-4) bonds in the latter.

(d) D-glucose in the former and L-glucose in the latter.

A

13

(1 extra credit)

Insulin is an example of a

(a) fatty acid.

(b) lipid.

(c) carbohydrate.

(d) protein.

D

 Set B

S. No.

(Marks)

Question

Answer

1

(1)

Penicillin is not the best treatment for  viral infections because

(a) viruses developed b-lactamase to destroy penicillins.

(b) some humans develop allergic reaction to penicillin.

(c) viruses lack peptidoglycans.

(d) viruses lack cellulose.

C

2

(1)

Membrane bilayer formation from monolayers is spontaneous in aqueous solutions and is facilitated primarily by 

(a) hydrogen bonds + hydrophobicity.

(b) electrostatic + van der Waals interactions

(c) van der Waals interactions + hydrophobicity.

(d) covalent bonds + hydrogen bonds

C

3

(2)

How many ORFs are there in a piece of double helical DNA represented in the 5’ to 3’ direction as TTAATGCATGACTTAATATAA

(a)  3

(b)  2

(c)  1

(d)  0

A

4

(1)

Tuberculosis is caused by a pathogen which belongs to

(a) eukaryotes.

(b) archaea.

(c) prokaryotes.

(d) fungi.

C

5

(2)

How many matches are found in the best possible alignment of the following two sequences:  DLQDRYFQ & DNYYQALQ

(a) 2

(b) 3

(c) 4

(d) 5

B

6

(1)

Humans can digest starch easily but not cellulose, although both contain glucose because of 

(a) b (1-4) bonds in the former and a (1-4) bonds in the latter.

(b) a (1-4) bonds in the former and b (1-4) bonds in the latter.

(c) a (1-6) bonds in the former and b (1-6) bonds in the latter.

(d) D-glucose in the former and L-glucose in the latter.

B

7

(2)

Suppose you wish to remove 5’ ΰ 3’ directionality in DNA by making it symmetric. You could do this by creating an additional  covalent bond or by cleaving an existing covalent bond.

(a) create a bond between C2’ and C5’ or cleave the bond between C2’ and C3’

(b) create  a bond between C3’ and C5’ or cleave the bond between C4’ and O

(c) create a bond between C2’ and C4’ or cleave the bond between C3’ and C5’

(d) create a bond between C1’ and C3’ or cleave the bond between C1’ and C2’

A

8

(1)

Human genome is made up of

(a) genes for mRNA, tRNA, rRNA, micro RNA.

(b) genes for proteins, lipids and carbohydrates.

(c) genes for all types of RNA and telomeres. 

(d) coding, noncoding and extragenic DNA.

D

9

(1)

What is reduced in Anfinsen’s experiments?

 (a) S-S bonds between methionines

 (b) S-S bonds between cysteines

 (c) Main chain carbonyl groups

(d) Side chain carbonyl groups

B

10

(1)

Simply stated, the difference between proteins bound in membranes and molecules in liquid crystals is that

(a) the former translate and rotate, the latter do not

(b) the former vibrate and the latter do not

(c) the former translate, the latter rotate

(d) the former rotate and the latter translate

C

11

(1)

 Insulin is an example of a

(a) carbohydrate.

(b) protein.

(c) fatty acid.

(d) lipid.

B

12

(1)

Designing antibodies to fight/recognize antigens  is an example of

(a) translation.

(b) replication.

(c) protein folding problem.

(d) inverse protein folding problem.

D

13

(1 extra credit)

Alternative splicing requires

(a) stem cells.

(b) ribosomes.

(c) meiosis.

(d) introns and exons.

D

Set C

S. No.

(Marks)

Question

Answer

1

(1)

Designing antibodies to fight/recognize antigens  is an example of

(a) inverse protein folding problem.

(b) protein folding problem.

(c) translation.

(d) replication.

A

2

(1)

Human genome is made up of

(a) genes for all types of RNA and telomeres. 

(b) coding, noncoding and extragenic DNA.

(c) genes for mRNA, tRNA, rRNA, micro RNA.

(d) genes for proteins, lipids and carbohydrates.

B

3

(1)

Penicillin is not the best treatment for  viral infections because

(a) viruses lack peptidoglycans.

(b) viruses lack cellulose.

(c) viruses developed b-lactamase to destroy penicillins.

(d) some humans develop allergic reaction to penicillin.

A

4

(1)

Insulin is an example of a

(a) fatty acid.

(b) protein.

(c) lipid.

(d) carbohydrate.

B

5

(2)

Suppose you wish to remove 5’ ΰ 3’ directionality in DNA by making it symmetric. You could do this by creating an additional  covalent bond or by cleaving an existing covalent bond.

(a) create  a bond between C3’ and C5’ or cleave the bond between C4’ and O

 (b) create a bond between C2’ and C4’ or cleave the bond between C3’ and C5’

 (c) create a bond between C2’ and C5’ or cleave the bond between C2’ and C3’

 (d) create a bond between C1’ and C3’ or cleave the bond between C1’ and C2’

C

6

(1)

Alternative splicing requires

(a) stem cells.

(b) ribosomes.

(c) meiosis.

(d) introns and exons.

D

7

(1)

Membrane bilayer formation from monolayers is spontaneous in aqueous solutions and is facilitated primarily by 

(a) hydrogen bonds + hydrophobicity.

(b) electrostatic + van der Waals interactions.

 (c) van der Waals interactions + hydrophobicity.

(d) covalent bonds + hydrogen bonds.

C

8

(1)

Simply stated, the difference between proteins bound in membranes and molecules in liquid crystals is that

(a) the former translate, the latter rotate

(b) the former translate and rotate, the latter do not

(c) the former vibrate and the latter do not

(d) the former rotate and the latter translate

A

9

(2)

How many matches are found in the best possible alignment of the following two sequences:  DLQDRYFQ & DNYYQALQ

(a) 5

(b) 4

(c) 3

(d) 2

C

10

(1)

Tuberculosis is caused by a pathogen which belongs to

(a) prokaryotes.

(b) eukaryotes.

(c) archaea.

(d) fungi.

A

11

(2)

How many ORFs are there in a piece of double helical DNA represented in the 5’ to 3’ direction as TTAATGCATGACTTAATATAA

(a)  1

(b)  2

(c)  3

(d)  0

C

12

(1)

Humans can digest starch easily but not cellulose, although both contain glucose because of 

(a) a (1-4) bonds in the former and b (1-4) bonds in the latter.

(b) a (1-6) bonds in the former and b (1-6) bonds in the latter.

(c) b (1-4) bonds in the former and a (1-4) bonds in the latter.

(d) D-glucose in the former and L-glucose in the latter.

A

13

(1 extra credit)

What is reduced in Anfinsen’s experiments?

(a) Main chain carbonyl groups

(b) Side chain carbonyl groups

(c) S-S bonds between methionines

(d) S-S bonds between cysteines

D

Set D

S. No.

(Marks)

Question

Answer

1

(2)

How many ORFs are there in a piece of double helical DNA represented in the 5’ to 3’ direction as TTAATGCATGACTTAATATAA

(a)  0

(b)  3

(c)  2

(d)  1

B

2

(2)

Suppose you wish to remove 5’ ΰ 3’ directionality in DNA by making it symmetric. You could do this by creating an additional  covalent bond or by cleaving an existing covalent bond.

(a) create  a bond between C3’ and C5’ or cleave the bond between C4’ and O

(b) create a bond between C2’ and C4’ or cleave the bond between C3’ and C5’

(c) create a bond between C1’ and C3’ or cleave the bond between C1’ and C2’

(d) create a bond between C2’ and C5’ or cleave the bond between C2’ and C3’

D

3

(2)

How many matches are found in the best possible alignment of the following two sequences:  DLQDRYFQ & DNYYQALQ

(a) 4

(b) 5

(c) 2

(d) 3

D

4

(1)

Human genome is made up of

(a) genes for mRNA, tRNA, rRNA, micro RNA.

(b) genes for proteins, lipids and carbohydrates.

(c) coding, noncoding and extragenic DNA.

(d) genes for all types of RNA and telomeres. 

C

5

(1)

Designing antibodies to fight/recognize antigens  is an example of

(a) replication.

(b) translation.

(c) protein folding problem.

(d) inverse protein folding problem.

D

6

(1)

Penicillin is not the best treatment for  viral infections because

(a) viruses developed b-lactamase to destroy penicillins.

(b) some humans develop allergic reaction to penicillin.

(c) viruses lack peptidoglycans.

(d) viruses lack cellulose.

C

7

(1)

Tuberculosis is caused by a pathogen which belongs to

(a) archaea.

(b) fungi.

(c) eukaryotes.

(d) prokaryotes.

D

8

(1)

Membrane bilayer formation from monolayers is spontaneous in aqueous solutions and is facilitated primarily by 

(a) van der Waals interactions + hydrophobicity.

(b) hydrogen bonds + hydrophobicity.

(c) electrostatic + van der Waals interactions

(d) covalent bonds + hydrogen bonds

A

9

(1)

Alternative splicing requires

(a) stem cells.

(b) introns and exons.

(c) ribosomes.

(d) meiosis.

B

10

(1)

Humans can digest starch easily but not cellulose, although both contain glucose because of 

(a) D-glucose in the former and L-glucose in the latter.

(b) b (1-4) bonds in the former and a (1-4) bonds in the latter.

(c) a (1-4) bonds in the former and b (1-4) bonds in the latter.

(d) a (1-6) bonds in the former and b (1-6) bonds in the latter.

C

11

(1)

Simply stated, the difference between proteins bound in membranes and molecules in liquid crystals is that

(a) the former translate and rotate, the latter do not

(b) the former translate, the latter rotate

(c) the former vibrate and the latter do not

(d) the former rotate and the latter translate

B

12

(1)

 Insulin is an example of a

(a) protein.

(b) fatty acid.

(c) lipid.

(d) carbohydrate.

A

13

(1 extra credit)

What is reduced in Anfinsen’s experiments?

(a) Main chain carbonyl groups

(b) Side chain carbonyl groups

(c) S-S bonds between cysteines

(d) S-S bonds between methionines

C

Set E

S. No.

(Marks)

Question

Answer

1

(1)

Simply stated, the difference between proteins bound in membranes and molecules in liquid crystals is that

(a) the former translate and rotate, the latter do not

(b) the former vibrate and the latter do not

(c) the former rotate and the latter translate

(d) the former translate, the latter rotate

D

2

(1)

Alternative splicing requires

(a) ribosomes.

(b) meiosis.

(c) introns and exons.

(d) stem cells.

C

3

(1)

Human genome is made up of

(a) genes for mRNA, tRNA, rRNA, micro RNA.

(b) genes for proteins, lipids and carbohydrates.

(c) genes for all types of RNA and telomeres. 

(d) coding, noncoding and extragenic DNA.

D

4

(1)

Penicillin is not the best treatment for  viral infections because

(a) viruses lack cellulose.

(b) viruses lack peptidoglycans.

(c) viruses developed b-lactamase to destroy penicillins.

(d) some humans develop allergic reaction to penicillin.

B

5

(2)

How many ORFs are there in a piece of double helical DNA represented in the 5’ to 3’ direction as TTAATGCATGACTTAATATAA

(a)  0

(b)  1

(c)  2

(d)  3

D

6

(1)

What is reduced in Anfinsen’s experiments?

(a) Main chain carbonyl groups

(b) Side chain carbonyl groups

(c) S-S bonds between methionines

(d) S-S bonds between cysteines

D

7

(1)

Insulin is an example of a

(a) fatty acid.

(b) lipid.

(c) protein.

(d) carbohydrate.

C

8

(1)

Tuberculosis is caused by a pathogen which belongs to

(a) prokaryotes.

(b) eukaryotes.

(c) archaea.

(d) fungi.

A

9

(1)

Humans can digest starch easily but not cellulose, although both contain glucose because of 

(a) D-glucose in the former and L-glucose in the latter.

(b) b (1-4) bonds in the former and a (1-4) bonds in the latter.

(c) a (1-6) bonds in the former and b (1-6) bonds in the latter.

(d) a (1-4) bonds in the former and b (1-4) bonds in the latter.

D

10

(2)

Suppose you wish to remove 5’ ΰ 3’ directionality in DNA by making it symmetric. You could do this by creating an additional  covalent bond or by cleaving an existing covalent bond.

(a) create  a bond between C3’ and C5’ or cleave the bond between C4’ and O

(b) create a bond between C2’ and C4’ or cleave the bond between C3’ and C5’

(c) create a bond between C2’ and C5’ or cleave the bond between C2’ and C3’

(d) create a bond between C1’ and C3’ or cleave the bond between C1’ and C2’

C

11

(2)

How many matches are found in the best possible alignment of the following two sequences:  DLQDRYFQ & DNYYQALQ

(a) 3

(b) 5

(c) 2

(d) 4

A

12

(1)

Membrane bilayer formation from monolayers is spontaneous in aqueous solutions and is facilitated primarily by 

(a) electrostatic + van der Waals interactions

(b) covalent bonds + hydrogen bonds

(c) hydrogen bonds + hydrophobicity.

(d) van der Waals interactions + hydrophobicity.

D

13

(1 extra credit)

Designing antibodies to fight/recognize antigens  is an example of

(a) protein folding problem.

(b) inverse protein folding problem.

(c) translation.

(d) replication.

B

 

 

Seating arrangement for Minor II to be held on 9th October 2016 at 0800 hrs

   

The easiest way to locate anyone is to "Ctrl-F" the name or entry number

Students MUST sit in their allocated room ONLY. The answer sheet of anyone NOT sitting in their allocated room will NOT be graded.

Lab group assignment Examination Seating
S. No.  Entry Number  Student Name  Lab Gp Day Time (hrs) Minor II
1 2013CE10317 ADITYA YADAV 1 Mon 1300-1500 LH 121
2 2013CE10343 GOLLA NAGA CHAITANYA 1 Mon 1300-1500 LH 121
3 2013CE10348 JITENDER KUMAR 1 Mon 1300-1500 LH 121
4 2013CE10356 MAHENDRA SINGH 1 Mon 1300-1500 LH 121
5 2013CE10381 RAHUL MEENA 1 Mon 1300-1500 LH 121
6 2013CE10395 SUBHAM MEENA 1 Mon 1300-1500 LH 121
7 2013CE10420 YATHARTH SETH 1 Mon 1300-1500 LH 121
8 2013CH10112 SAGAR MITTAL 1 Mon 1300-1500 LH 121
9 2013CH70165 NIKHIL AGRAWAL 1 Mon 1300-1500 LH 121
10 2013CS10214 ASHISH KUMAR SINGH 1 Mon 1300-1500 LH 121
11 2013CS50277 ANAGH PRASAD 1 Mon 1300-1500 LH 121
12 2013EE10492 SAROJ KUMAR 1 Mon 1300-1500 LH 121
13 2013ME10641 AGRAWAL SHUBHAM RAJIV 1 Mon 1300-1500 LH 121
14 2013ME10688 LAVIT GOSWAMI 1 Mon 1300-1500 LH 121
15 2013ME10729 SUBHASISH DAS 1 Mon 1300-1500 LH 121
16 2013ME10736 VANKADOTH ESHWAR NAIK 1 Mon 1300-1500 LH 121
17 2013ME20807 YELLA RAVI TEJA 1 Mon 1300-1500 LH 121
18 2013MT60598 HIMANSHU GUPTA 1 Mon 1300-1500 LH 121
19 2013PH10822 AASTHA 1 Mon 1300-1500 LH 121
20 2013PH10829 AKSHAY PRASHANT HEGDE 1 Mon 1300-1500 LH 121
21 2013PH10834 ANKIP KUMAR 1 Mon 1300-1500 LH 121
22 2013PH10845 GAURAV RAWAT 1 Mon 1300-1500 LH 121
23 2013PH10856 NAVEEN YADAV 1 Mon 1300-1500 LH 121
24 2013PH10864 RISHABH MALLIK 1 Mon 1300-1500 LH 121
25 2013PH10869 SHAUNAK SANJAY THAKAR 1 Mon 1300-1500 LH 121
26 2013PH10881 VISHAL KUMAR 1 Mon 1300-1500 LH 121
27 2014CE10392 SUNIL KUMAR MEENA 1 Mon 1300-1500 LH 121
28 2014CE10395 SURAJ KUMAR 1 Mon 1300-1500 LH 121
29 2014CS10233 MAYANK RAJORIA 1 Mon 1300-1500 LH 121
30 2014CS10266 VIPPARTHY SAI ESVAR 1 Mon 1300-1500 LH 121
31 2014TT10169 JYOTI CHHANWAL 1 Mon 1300-1500 LH 121
32 2014TT10185 SHAILA KAROLE 1 Mon 1300-1500 LH 121
33 2014TT10856 ABHINAV SAHARAN 1 Mon 1300-1500 LH 121
34 2014TT10866 ANKIT 1 Mon 1300-1500 LH 121
35 2014TT10885 HIRA DURRANI 1 Mon 1300-1500 LH 121
36 2015CH10136 SUNAJE BHUSHAN 1 Mon 1300-1500 LH 121
37 2015CH70174 PARIDHI GUPTA 1 Mon 1300-1500 LH 121
38 2015CS10260 SHUBHAM SINGH TANWAR 1 Mon 1300-1500 LH 121
39 2015MT10608 PRANAV GOTHWAL 1 Mon 1300-1500 LH 121
40 2015PH10838 YARLAGADDA SANKARA DINESH 1 Mon 1300-1500 LH 121
41 2015TT10854 AYUSHI NARULA 1 Mon 1300-1500 LH 121
42 2015TT10856 ABHISHEK AGRAWAL 1 Mon 1300-1500 LH 121
43 2015TT10863 MINAAL DEMBLA 1 Mon 1300-1500 LH 121
44 2015TT10874 ANKUSH MANGAL 1 Mon 1300-1500 LH 121
45 2015TT10884 DAKSH CHANDRA BANSAL 1 Mon 1300-1500 LH 121
46 2015TT10887 DEEPALI VERMA 1 Mon 1300-1500 LH 121
47 2015TT10892 DHRUV GUPTA 1 Mon 1300-1500 LH 121
48 2015TT10917 NAVREET KAUR 1 Mon 1300-1500 LH 121
49 2015TT10921 PIYUSH GUPTA 1 Mon 1300-1500 LH 121
50 2015TT10932 REEWA GAUTAM 1 Mon 1300-1500 LH 121
51 2015TT10937 SHEETAL SHRAISTH 1 Mon 1300-1500 LH 121
52 2013TT10891 AASHNA MEHRA 2 Mon 1500-1700 LH 121
53 2013TT10912 AYUSH JAIN 2 Mon 1500-1700 LH 121
54 2013TT10938 KARISHMA DHAKAD 2 Mon 1500-1700 LH 121
55 2013TT10956 RAVI SONKRIYA 2 Mon 1500-1700 LH 121
56 2013TT10962 SAUBHAGYA SONAL 2 Mon 1500-1700 LH 121
57 2013TT10974 UJJAWAL MALIK 2 Mon 1500-1700 LH 121
58 2013TT10979 VISHAL 2 Mon 1500-1700 LH 121
59 2014BB10037 GULSHAN VERMA 2 Mon 1500-1700 LH 121
60 2014CE10308 AKHILESH KUMAR 2 Mon 1500-1700 LH 121
61 2014CE10309 ALOK KUMAR 2 Mon 1500-1700 LH 121
62 2014CE10311 AMAN GUPTA 2 Mon 1500-1700 LH 121
63 2014CE10317 ANSHU RANJAN 2 Mon 1500-1700 LH 121
64 2014CE10320 ANUBHAV SHARMA 2 Mon 1500-1700 LH 121
65 2014CE10329 AYUSH VARSHNEY 2 Mon 1500-1700 LH 121
66 2014CE10332 BRAJ KANT 2 Mon 1500-1700 LH 121
67 2014CE10333 BRIJVASI MEENA 2 Mon 1500-1700 LH 121
68 2014CE10336 DHARAM SINGH MEENA 2 Mon 1500-1700 LH 121
69 2014CE10347 MOHIT PAHUJA 2 Mon 1500-1700 LH 121
70 2014CE10356 PREMANJAN SUNA 2 Mon 1500-1700 LH 121
71 2014CE10358 RAGHAV RATTAN 2 Mon 1500-1700 LH 121
72 2014CE10370 RIYA AGARWAL 2 Mon 1500-1700 LH 121
73 2014CE10372 SAMARTH GOYAL 2 Mon 1500-1700 LH 121
74 2014CE10373 SAMEER TRIPATHI 2 Mon 1500-1700 LH 121
75 2014CE10374 SANDEEP 2 Mon 1500-1700 LH 121
76 2014CE10376 SAURAV SUMAN 2 Mon 1500-1700 LH 121
77 2014CE10378 SHEIK MOHAMMED YAHYA S 2 Mon 1500-1700 LH 121
78 2014CE10387 SIDDHARTH K MISRA 2 Mon 1500-1700 LH 121
79 2014CE10390 SUMIT SHARMA 2 Mon 1500-1700 LH 121
80 2014CE10391 SUMIT YADAV 2 Mon 1500-1700 LH 121
81 2014CE10393 SUNIL YADAV 2 Mon 1500-1700 LH 121
82 2014CE10398 TUSHAR GOYAL 2 Mon 1500-1700 LH 121
83 2014CE10405 YUVRAJ SURYAVANSHI 2 Mon 1500-1700 LH 121
84 2014CE10851 A ABHISHEK ARUNACHALAM 2 Mon 1500-1700 LH 121
85 2015BB10021 ABHINAV ARORA 2 Mon 1500-1700 LH 121
86 2015BB10023 ADHHAYAN 2 Mon 1500-1700 LH 121
87 2015BB10025 AKASHI NEGI 2 Mon 1500-1700 LH 121
88 2015BB10027 ANJALI CHOURDIA 2 Mon 1500-1700 LH 121
89 2015BB10029 ARNAV KARAN 2 Mon 1500-1700 LH 121
90 2015BB10033 EASH SHARMA 2 Mon 1500-1700 LH 121
91 2015BB10037 HIMANSHU SINGH SAGAR 2 Mon 1500-1700 LH 121
92 2015BB10041 KUMAR KOMALESHWARI RANI NARESH 2 Mon 1500-1700 LH 121
93 2015BB10043 MALLIKA SINGLA 2 Mon 1500-1700 LH 121
94 2015BB10047 PALLAVI MISRA 2 Mon 1500-1700 LH 121
95 2015BB10051 PRINCE AGRAWAL 2 Mon 1500-1700 LH 121
96 2015BB10055 RAKESH KUMAR SUKHANI 2 Mon 1500-1700 LH 121
97 2015BB10059 SHIVAM SAHU 2 Mon 1500-1700 LH 121
98 2015BB10061 SUSHANT KHARE 2 Mon 1500-1700 LH 121
99 2015BB10065 VIKRANT YADAV 2 Mon 1500-1700 LH 121
100 2015BB50001 A R SHUBHAM 2 Mon 1500-1700 LH 121
101 2015BB50003 BHARTI MEENA 2 Mon 1500-1700 LH 121
102 2015BB50005 INDHANA DIVYA JAYASREE 2 Mon 1500-1700 LH 121
103 2015BB50007 KANCHARANA PREETI RAJ 2 Mon 1500-1700 LH 121
104 2015BB50009 DHAVAL RAKESH NARWANI 2 Mon 1500-1700 LH 121
105 2015BB50011 PATNANA MOUNICA 2 Mon 1500-1700 LH 121
106 2015BB50013 SASHI KALAN 2 Mon 1500-1700 LH 121
107 2015BB50015 YUGESH VERMA 2 Mon 1500-1700 LH 121
108 2015CS10291 SANGNIE  BHARDWAJ 2 Mon 1500-1700 LH 121
109 2015ME20726 AYUSH JINDAL 2 Mon 1500-1700 LH 121
110 2015PH10822 SAGARE CHETAN BASAWARAJ 2 Mon 1500-1700 LH 121
111 2013CH10074 ANTRIKSH JOHRI 3 Tues 1300-1500 LH 121
112 2013CH10115 SARTHAK SAINI 3 Tues 1300-1500 LH 121
113 2013CH10119 SAURABH DOGRA 3 Tues 1300-1500 LH 121
114 2013CH70170 ROHAN KHANDELWAL 3 Tues 1300-1500 LH 121
115 2013PH10843 DASHMEET SINGH ISSER 3 Tues 1300-1500 LH 121
116 2014CE10301 AARUSH GUPTA 3 Tues 1300-1500 LH 121
117 2014CE10304 ABHISHEK PRATAP SINGH 3 Tues 1300-1500 LH 121
118 2014CE10307 AKHIL GOYAL 3 Tues 1300-1500 LH 121
119 2014CE10312 AMOL SINGH 3 Tues 1300-1500 LH 121
120 2014CE10315 ANKIT KUMAR 3 Tues 1300-1500 LH 121
121 2014CE10318 ANSHUL PAREEK 3 Tues 1300-1500 LH 121
122 2014CE10322 ARPIT GUNAWAT 3 Tues 1300-1500 LH 121
123 2014CE10323 ARUSH VERMA 3 Tues 1300-1500 LH 121
124 2014CE10324 ARVIND KUMAR 3 Tues 1300-1500 LH 121
125 2014CE10327 ATISH SAURAV 3 Tues 1300-1500 LH 121
126 2014CE10330 B CHANDRAKANTH 3 Tues 1300-1500 LH 121
127 2014CE10331 BHARAT KUMAR SHARMA 3 Tues 1300-1500 LH 121
128 2014CE10335 DEVESH SHUKLA 3 Tues 1300-1500 LH 121
129 2014CE10337 DHRUV SOOD 3 Tues 1300-1500 LH 121
130 2014CE10340 HARSHA TIWARI 3 Tues 1300-1500 LH 121
131 2014CE10344 KINRA MOHIT LALIT 3 Tues 1300-1500 LH 121
132 2014CE10350 NIMMA SANTOSH 3 Tues 1300-1500 LH 121
133 2014CE10351 NITIN KUMAR 3 Tues 1300-1500 LH 121
134 2014CE10353 PAWAN JOON 3 Tues 1300-1500 LH 121
135 2014CE10359 RAJEEV KUMAR 3 Tues 1300-1500 LH 121
136 2014CE10360 RAJESH NARRAVULA 3 Tues 1300-1500 LH 121
137 2014CE10361 RAKESH CHOUDHARY 3 Tues 1300-1500 LH 121
138 2014CE10364 RAVI KUMAR MAHAWAR 3 Tues 1300-1500 LH 121
139 2014CE10366 RAVI KUMAR MITTAL 3 Tues 1300-1500 LH 121
140 2014CE10375 SANYAM GUPTA 3 Tues 1300-1500 LH 121
141 2014CE10379 SHIVAM KOUSHAL 3 Tues 1300-1500 LH 121
142 2014CE10381 SHIVAM RANA 3 Tues 1300-1500 LH 121
143 2014CE10384 SHUBHAM CHAUDHARY 3 Tues 1300-1500 LH 121
144 2014CE10388 SOURABH MHASKI 3 Tues 1300-1500 LH 121
145 2014CE10400 VAIBHAV MEHTA 3 Tues 1300-1500 LH 121
146 2014CH10112 NAMAN AGRAWAL 3 Tues 1300-1500 LH 121
147 2014EE10470 PRASHANTH M 3 Tues 1300-1500 LH 121
148 2014TT10881 DIVYAM GUPTA 3 Tues 1300-1500 LH 121
149 2015BB10038 MIHIR CHANDRASHEKHAR JAIN 3 Tues 1300-1500 LH 121
150 2015BB10040 JEETU SINGH 3 Tues 1300-1500 LH 121
151 2015BB10042 LAMGHARE ADITYA RAJU 3 Tues 1300-1500 LH 325
152 2015BB10046 PAHADE ASMITA KAMALKUMAR 3 Tues 1300-1500 LH 325
153 2015BB10048 PIYUSH KUMAR 3 Tues 1300-1500 LH 325
154 2015BB10050 PRAJJWAL SIHAG 3 Tues 1300-1500 LH 325
155 2015BB10052 PUNEET LAGOO 3 Tues 1300-1500 LH 325
156 2015BB10054 RAJ KUMAR RAVIDAS 3 Tues 1300-1500 LH 325
157 2015BB10056 ROSHINEE P 3 Tues 1300-1500 LH 325
158 2015CS50277 AMOL MUKESH BAMBODE 3 Tues 1300-1500 LH 325
159 2014CH10077 AJAY PRAKASH SRIVATSA 4 Tues 1500-1700 LH 325
160 2014CH10090 ASHWIN BHOLA 4 Tues 1500-1700 LH 325
161 2014CH10097 GANVIR PRANIT KIRAN 4 Tues 1500-1700 LH 325
162 2014CH10121 RATNESH NATH 4 Tues 1500-1700 LH 325
163 2014CH10128 SANKALP KUMAR MAURYA 4 Tues 1500-1700 LH 325
164 2014CH10145 VIKAS MEENA 4 Tues 1500-1700 LH 325
165 2014CH70194 UDIT S BEHL 4 Tues 1500-1700 LH 325
166 2014CS10202 ABHIJEET ANAND 4 Tues 1500-1700 LH 325
167 2014CS10203 ABHILASH RAMTEKE 4 Tues 1500-1700 LH 325
168 2014CS10204 ABHISHEK SANGWAN 4 Tues 1500-1700 LH 325
169 2014CS10207 AGRAWAL PRAKHAR YOGESH 4 Tues 1500-1700 LH 325
170 2014CS10211 ARKAPRAVA SAHA 4 Tues 1500-1700 LH 325
171 2014CS10213 AYUSHYA RAJ 4 Tues 1500-1700 LH 325
172 2014CS10218 DIVYANSH 4 Tues 1500-1700 LH 325
173 2014CS10219 GANGASANI SAI SRIMANTH 4 Tues 1500-1700 LH 325
174 2014CS10220 GURTEJ SINGH SOHI 4 Tues 1500-1700 LH 325
175 2014CS10221 HARSH ARYA 4 Tues 1500-1700 LH 325
176 2014CS10222 HARSHIL R MEENA 4 Tues 1500-1700 LH 325
177 2014CS10225 JATIN YADAV 4 Tues 1500-1700 LH 325
178 2014CS10229 KISHALAY RAJ 4 Tues 1500-1700 LH 325
179 2014CS10230 KRITARTH 4 Tues 1500-1700 LH 325
180 2014CS10232 KUSHAGRA MADAN 4 Tues 1500-1700 LH 325
181 2014CS10237 MOHIT BAJAJ 4 Tues 1500-1700 LH 325
182 2014CS10243 NETHALA BILVA TEJA BALA TATAJI RAO 4 Tues 1500-1700 LH 325
183 2014CS10244 NITIN RATHOR 4 Tues 1500-1700 LH 325
184 2014CS10246 PRAGNESH JOGADIYA 4 Tues 1500-1700 LH 325
185 2014CS10248 RAHUL KUMAR 4 Tues 1500-1700 LH 325
186 2014CS10255 SHUBH CHAURASIA 4 Tues 1500-1700 LH 325
187 2014CS10256 SHUBHAM RATHI 4 Tues 1500-1700 LH 325
188 2014CS10258 SOURAV DAS 4 Tues 1500-1700 LH 325
189 2014CS10260 TUHINANKSU DAS 4 Tues 1500-1700 LH 325
190 2014CS10261 UJJWAL KUMAR 4 Tues 1500-1700 LH 325
191 2014CS10264 VIKAS CHOUHAN 4 Tues 1500-1700 LH 325
192 2014CS10267 VISHNU BHALAKI 4 Tues 1500-1700 LH 325
193 2014CS10268 WAGHMARE SAURABH MILIND 4 Tues 1500-1700 LH 325
194 2014CS10290 PRAKHAR GUPTA 4 Tues 1500-1700 LH 325
195 2014CS50286 KARTAR SINGH 4 Tues 1500-1700 LH 325
196 2014CS50291 PUNIT TIGGA 4 Tues 1500-1700 LH 325
197 2014CS50294 SHOVAN PAUL 4 Tues 1500-1700 LH 325
198 2014CS50736 KAPIL KUMAR 4 Tues 1500-1700 LH 325
199 2015BB10022 ABHISHEK KUMAR SAHU 4 Tues 1500-1700 LH 325
200 2015BB10024 AISHVI JAIN 4 Tues 1500-1700 LH 325
201 2015BB10026 AMRITANSHU 4 Tues 1500-1700 LH 325
202 2015BB10028 ANKIT KUMRAWAT 4 Tues 1500-1700 LH 325
203 2015BB10030 ASHWIN GARG 4 Tues 1500-1700 LH 325
204 2015BB10032 DEEPESH NATHANI 4 Tues 1500-1700 LH 325
205 2015BB10034 GUDDU KUMAR 4 Tues 1500-1700 LH 325
206 2015BB10036 HIMANI GAUTAM KAMBALE 4 Tues 1500-1700 LH 325
207 2015BB10058 SATYAM NATHANI 4 Tues 1500-1700 LH 325
208 2015BB10060 SHRADHA SAINI 4 Tues 1500-1700 LH 325
209 2015ME20720 ANSH JAIN 4 Tues 1500-1700 LH 325
210 2015PH10790 AMIT KUMAR 4 Tues 1500-1700 LH 325
211 2015PH10796 CHEENA AGARWAL 4 Tues 1500-1700 LH 325
212 2015PH10812 NAYANTARA MUDUR 4 Tues 1500-1700 LH 325
213 2015PH10840 YASHTI AGRAWAL 4 Tues 1500-1700 LH 325
214 2013CH70146 AKASH SINGH 5 Wed 1300-1500 LH 325
215 2013CH70162 MAYANK DEEP BANSOD 5 Wed 1300-1500 LH 325
216 2013ME10741 YANDA PRAVEEN KUMAR 5 Wed 1300-1500 LH 325
217 2015CH10002 ADITI  MAHAJAN 5 Wed 1300-1500 LH 325
218 2015CH10071 ABHAY KUMAR SAROTHIA 5 Wed 1300-1500 LH 325
219 2015CH10073 ABHIPRAI MISRA 5 Wed 1300-1500 LH 325
220 2015CH10075 ABHISHEK SINGH 5 Wed 1300-1500 LH 325
221 2015CH10076 ABHISHREE ARORA 5 Wed 1300-1500 LH 325
222 2015CH10077 ADARSH SAINI 5 Wed 1300-1500 LH 325
223 2015CH10081 AMAN VERMA 5 Wed 1300-1500 LH 325
224 2015CH10082 AMITESH RATHI 5 Wed 1300-1500 LH 325
225 2015CH10083 ANIKET KUMAR 5 Wed 1300-1500 LH 325
226 2015CH10084 ANISH KUJUR 5 Wed 1300-1500 LH 325
227 2015CH10085 ANSHIL CHANDRA 5 Wed 1300-1500 LH 325
228 2015CH10086 ANURAG DEEDWANIYA 5 Wed 1300-1500 LH 325
229 2015CH10087 ARNAB MANDAL 5 Wed 1300-1500 LH 325
230 2015CH10089 ARYAMAN BANSAL 5 Wed 1300-1500 LH 325
231 2015CH10090 ATUL YADAV 5 Wed 1300-1500 LH 325
232 2015CH10091 BANDISH PARIKH 5 Wed 1300-1500 LH 325
233 2015CH10092 BHAVYA DHURIA 5 Wed 1300-1500 LH 325
234 2015CH10093 CHANCHAL MEENA 5 Wed 1300-1500 LH 325
235 2015CH10094 DEVANDRA GODARA 5 Wed 1300-1500 LH 325
236 2015CH10095 DHANANJAY MEENA 5 Wed 1300-1500 LH 325
237 2015CH10096 DHARAM RAJ MEENA 5 Wed 1300-1500 LH 325
238 2015CH10097 DIKSHANT MAKHIJA 5 Wed 1300-1500 LH 325
239 2015CH10098 DIVYA SINGH 5 Wed 1300-1500 LH 325
240 2015CH10099 DIVYANK MITTAL 5 Wed 1300-1500 LH 325
241 2015CH10100 HARNEET SINGH 5 Wed 1300-1500 LH 325
242 2015CH10103 JATIN SHARMA 5 Wed 1300-1500 LH 325
243 2015CH10104 KRITIKA SHARMA 5 Wed 1300-1500 LH 325
244 2015CH10105 KSHITIJ GOEL 5 Wed 1300-1500 LH 325
245 2015CH10106 KUMAR UTKARSH 5 Wed 1300-1500 LH 325
246 2015CH10107 LALIT SWAMI 5 Wed 1300-1500 LH 325
247 2015CH10109 MILIND DHANRAJ ZODE 5 Wed 1300-1500 LH 325
248 2015CH10116 NIKHIL KUMAR MEENA 5 Wed 1300-1500 LH 325
249 2015CH10117 NISHA SINGH 5 Wed 1300-1500 LH 325
250 2015CH10119 PARTH RAJORA 5 Wed 1300-1500 LH 325
251 2015CH10122 PULKIT SRIVASTAVA 5 Wed 1300-1500 LH 325
252 2015CH10123 PULKIT LANGAN 5 Wed 1300-1500 LH 325
253 2015CH10124 RITIK CHAWLA 5 Wed 1300-1500 LH 325
254 2015CH10125 SAKSHAM GUPTA 5 Wed 1300-1500 LH 325
255 2015CH10126 SHALINI GUPTA 5 Wed 1300-1500 LH 325
256 2015CH10127 SHASHANK GUPTA 5 Wed 1300-1500 LH 325
257 2015CH10130 SHUBHAM 5 Wed 1300-1500 LH 325
258 2015CH10131 SIDDHARTH SACHAN 5 Wed 1300-1500 LH 325
259 2015CH10132 SIMRAN MALIK 5 Wed 1300-1500 LH 325
260 2015CH10133 SMARTH VEER SIDANA 5 Wed 1300-1500 LH 325
261 2015CH10134 SOUMYA PRAKASH BEHERA 5 Wed 1300-1500 LH 325
262 2015CH10135 SUBHANKAR DASH 5 Wed 1300-1500 LH 325
263 2015CH10137 SUNINT SINGH KHURANA 5 Wed 1300-1500 LH 325
264 2015CH10138 SUSHREE JAGRITI SAHOO 5 Wed 1300-1500 LH 325
265 2015CH10139 UDAIVEER 5 Wed 1300-1500 LH 325
266 2015CH10140 UJJWAL NARWAL 5 Wed 1300-1500 LH 325
267 2015CH10144 VINAYAK GUPTA 5 Wed 1300-1500 LH 325
268 2015CH10145 VISHESH GOYAL 5 Wed 1300-1500 LH 325
269 2015ME20711 AJAYENDRA SINGH 5 Wed 1300-1500 LH 325
270 2013CH70163 NAKUL BAHMANIA 6 Wed 1500-1700 LH 325
271 2013ME10653 BANAVATH ROOPESH 6 Wed 1500-1700 LH 325
272 2013ME10656 CHEEKATI RAKESH BABU 6 Wed 1500-1700 LH 325
273 2013ME20771 BACHANTI KRISHNA 6 Wed 1500-1700 LH 325
274 2014CH70184 SHAH SHREYANS SHRENIK 6 Wed 1500-1700 LH 325
275 2014EE30503 ARUN KUMAR MEENA 6 Wed 1500-1700 LH 325
276 2014ME20725 GAURAV SINGH 6 Wed 1500-1700 LH 325
277 2014MT10045 NIHARIKA 6 Wed 1500-1700 LH 325
278 2014MT10584 AKSHAY KUMAR 6 Wed 1500-1700 LH 325
279 2014MT10602 RIMSHA KHAN 6 Wed 1500-1700 LH 325
280 2014MT10613 SUBODH PUSHKAR 6 Wed 1500-1700 LH 325
281 2014TT10932 SANDEEP KUMAR 6 Wed 1500-1700 LH 325
282 2015BB10062 SWAPNIL SINHA 6 Wed 1500-1700 LH 325
283 2015BB10064 VANISHA 6 Wed 1500-1700 LH 325
284 2015BB50004 DIVYA GARG 6 Wed 1500-1700 LH 325
285 2015BB50006 JASHAN SINGH SURI 6 Wed 1500-1700 LH 325
286 2015BB50008 MAYANK MODI 6 Wed 1500-1700 LH 325
287 2015BB50010 NITESH CHAUDHARY 6 Wed 1500-1700 LH 325
288 2015BB50012 PRARTHANA JAIN 6 Wed 1500-1700 LH 325
289 2015CH10128 SHASHWAT SINGH 6 Wed 1500-1700 LH 325
290 2015CH10129 SHRABAN DAS 6 Wed 1500-1700 LH 325
291 2015CH10142 VATSAL SHARMA 6 Wed 1500-1700 LH 325
292 2015CH10143 VIKAS SINGH 6 Wed 1500-1700 LH 325
293 2015CH10385 SHUBHIKA  JAIN 6 Wed 1500-1700 LH 325
294 2015CH10945 SURBHI  JAIN 6 Wed 1500-1700 LH 325
295 2015CH70151 ADITYA CHOUDHARY 6 Wed 1500-1700 LH 325
296 2015CH70153 ANUJ SAHU 6 Wed 1500-1700 LH 325
297 2015CH70154 ANURAG RATHORE 6 Wed 1500-1700 LH 325
298 2015CH70155 ARCHIT AGGARWAL 6 Wed 1500-1700 LH 325
299 2015CH70156 BANSOD YASH RAJU 6 Wed 1500-1700 LH 325
300 2015CH70158 DEVENDRA 6 Wed 1500-1700 LH 325
301 2015CH70159 DEVENDRA DEWANDA 6 Wed 1500-1700 LH 108
302 2015CH70160 DIGVIJAY DAS 6 Wed 1500-1700 LH 108
303 2015CH70161 HARILAL KRISHNA 6 Wed 1500-1700 LH 108
304 2015CH70162 HERALE ANUSHKA ANANTHRAJ 6 Wed 1500-1700 LH 108
305 2015CH70163 JAYA MEENA 6 Wed 1500-1700 LH 108
306 2015CH70165 KIRAN JAIN 6 Wed 1500-1700 LH 108
307 2015CH70167 MOHAMMAD AREEB AFZAL 6 Wed 1500-1700 LH 108
308 2015CH70168 MUKUL MITTAL 6 Wed 1500-1700 LH 108
309 2015CH70170 NAZISH AMBER 6 Wed 1500-1700 LH 108
310 2015CH70171 NEHA KASWAN 6 Wed 1500-1700 LH 108
311 2015CH70173 PAL PRAKHAR SINGH 6 Wed 1500-1700 LH 108
312 2015CH70176 PRAJVAL KUMAR 6 Wed 1500-1700 LH 108
313 2015CH70178 PRASHANT CHOHLA 6 Wed 1500-1700 LH 108
314 2015CH70181 RATHOD RUDRA 6 Wed 1500-1700 LH 108
315 2015CH70183 SARANSH MAHESHWARI 6 Wed 1500-1700 LH 108
316 2015CH70184 SARTHAK KALA 6 Wed 1500-1700 LH 108
317 2015CH70185 SAURABH SUBRAMANIAM 6 Wed 1500-1700 LH 108
318 2015CH70186 SHIVANSHU VERMA 6 Wed 1500-1700 LH 108
319 2015CH70187 SIMAR KAUR MATTEWAL 6 Wed 1500-1700 LH 108
320 2015CH70188 SOURABH GOLE 6 Wed 1500-1700 LH 108
321 2015CH70189 SUHANI AGARWAL 6 Wed 1500-1700 LH 108
322 2015CH70191 SWAPNIL S MAVLIKAR 6 Wed 1500-1700 LH 108
323 2015CH70193 VAIBHAV SHARMA 6 Wed 1500-1700 LH 108
324 2015CH70194 VASHISTHA ANURAG MAHESHCHANDRA 6 Wed 1500-1700 LH 108
325 2015CH70195 Y NIKHIL VARMA 6 Wed 1500-1700 LH 108
326 2013CE10391 SHISHIR SHARMA 7 Thurs 1300-1500 LH 108
327 2013CH10077 BHATRAJU CHAITANYA 7 Thurs 1300-1500 LH 108
328 2013CH10078 BURUJULA HARISH KUMAR 7 Thurs 1300-1500 LH 108
329 2013CH10080 HARDEEP SINGH 7 Thurs 1300-1500 LH 108
330 2013CH10081 HIMANSHI GAUTAM 7 Thurs 1300-1500 LH 108
331 2013CH10094 OJASVI MONGA 7 Thurs 1300-1500 LH 108
332 2013CH10096 PRAKHAR GUPTA 7 Thurs 1300-1500 LH 108
333 2013CH10099 RAJAT GARG 7 Thurs 1300-1500 LH 108
334 2013CH10122 SHOURI SRINIVAS CHIKKERUR 7 Thurs 1300-1500 LH 108
335 2013CH10129 SURBHI SINGLA 7 Thurs 1300-1500 LH 108
336 2013CH70145 AKARSH KUMAR SAHAY 7 Thurs 1300-1500 LH 108
337 2013CH70151 ANKIT JATAV 7 Thurs 1300-1500 LH 108
338 2013CH70156 DEVESH PATEL 7 Thurs 1300-1500 LH 108
339 2013CH70369 PALASH NANDWANI 7 Thurs 1300-1500 LH 108
340 2014CE10060 SIDDHARTH CHAUHAN 7 Thurs 1300-1500 LH 108
341 2014CE10157 ANIL BASAK 7 Thurs 1300-1500 LH 108
342 2014CE10302 ABHAY KUMAR SONKER 7 Thurs 1300-1500 LH 108
343 2014CE10305 ABHISHEK GOSWAMI 7 Thurs 1300-1500 LH 108
344 2014CE10313 ANGAJALA SRI NEELESH KUMAR 7 Thurs 1300-1500 LH 108
345 2014CE10314 ANIRUDH MODI 7 Thurs 1300-1500 LH 108
346 2014CE10319 ANSHUL TITORIA 7 Thurs 1300-1500 LH 108
347 2014CE10321 ARMINDER SINGH 7 Thurs 1300-1500 LH 108
348 2014CE10325 ASHUTOSH SHARMA 7 Thurs 1300-1500 LH 108
349 2014CE10326 ASHUTOSH SINGH 7 Thurs 1300-1500 LH 108
350 2014CE10328 AYUSH JAIN 7 Thurs 1300-1500 LH 108
351 2014CE10334 CHIDURALA SUNNY KASHYAP 7 Thurs 1300-1500 LH 108
352 2014CE10339 GAURAV ATTRI 7 Thurs 1300-1500 LH 108
353 2014CE10342 HIMANSHU SINGH 7 Thurs 1300-1500 LH 108
354 2014CE10345 M AKHIL 7 Thurs 1300-1500 LH 108
355 2014CE10348 MUSTYALA VARUN 7 Thurs 1300-1500 LH 108
356 2014CE10349 NEERAJ MEENA 7 Thurs 1300-1500 LH 108
357 2014CE10354 PRAJWAL LOHAN 7 Thurs 1300-1500 LH 108
358 2014CE10363 RAVALIYA RAHUL HASMUKHBHAI 7 Thurs 1300-1500 LH 108
359 2014CE10371 ROHIT YADAV 7 Thurs 1300-1500 LH 108
360 2014CE10377 SHASHWAT TRIPURARI 7 Thurs 1300-1500 LH 108
361 2014CE10380 SHIVAM PRAJAPATI 7 Thurs 1300-1500 LH 108
362 2014CE10383 SHUBHAM AGRAWAL 7 Thurs 1300-1500 LH 108
363 2014CE10386 SHYAM SUNDAR SONI 7 Thurs 1300-1500 LH 108
364 2014CE10389 SUDHANSHU SINGH 7 Thurs 1300-1500 LH 108
365 2014CE10394 SURAJ KUMAR 7 Thurs 1300-1500 LH 108
366 2014CE10396 TANUJ SHARMA 7 Thurs 1300-1500 LH 108
367 2014CE10397 TINISH GUPTA 7 Thurs 1300-1500 LH 108
368 2014CE10402 VINAY YADAV 7 Thurs 1300-1500 LH 108
369 2014CE10404 VIVEK DIXIT 7 Thurs 1300-1500 LH 108
370 2014CE10936 SEEMA SHROTRIYA 7 Thurs 1300-1500 LH 108
371 2015ME20729 BHAVYA KAUSHIK 7 Thurs 1300-1500 LH 108
372 2014TT10904 MOHIT CHAUHAN 7 Thurs 1300-1500 LH 108
373 2014TT10906 MUKUL KRISHAN AGARWAL 7 Thurs 1300-1500 LH 108
374 2014TT10912 PRABHAT PALIYA 7 Thurs 1300-1500 LH 108
375 2014TT10951 VIKASH KUMAR 7 Thurs 1300-1500 LH 108
376 2013CH10061 AASTHA DHIMAN 8 Thurs 1500-1700 LH 111
377 2014CS10206 ADITYA KUMAR 8 Thurs 1500-1700 LH 111
378 2014CS10228 KIRAN KUMAR METTA 8 Thurs 1500-1700 LH 111
379 2014CS10238 MUKUND RUNGTA 8 Thurs 1500-1700 LH 111
380 2014CS10254 SHRISTI GOYAL 8 Thurs 1500-1700 LH 111
381 2015BB10053 RAHUL KHETAN 8 Thurs 1500-1700 LH 111
382 2015BB10057 SAMYAK JAIN 8 Thurs 1500-1700 LH 111
383 2015BB10063 UTSAV CHAWLA 8 Thurs 1500-1700 LH 111
384 2015CH10088 ARSH SINGH CHAUHAN 8 Thurs 1500-1700 LH 111
385 2015CS10207 ADITYA SAHDEV 8 Thurs 1500-1700 LH 111
386 2015CS10208 AKASH MITTAL 8 Thurs 1500-1700 LH 111
387 2015CS10213 ANUJ DHAWAN 8 Thurs 1500-1700 LH 111
388 2015CS10225 DHOLE SHREYAS KIRAN 8 Thurs 1500-1700 LH 111
389 2015CS10229 J ROSHAN NAIK 8 Thurs 1500-1700 LH 111
390 2015CS10234 KARTIKEYA SHARMA 8 Thurs 1500-1700 LH 111
391 2015CS10235 MADHUR SINGHAL 8 Thurs 1500-1700 LH 111
392 2015CS10237 MAYANK ANEJA 8 Thurs 1500-1700 LH 111
393 2015CS10241 OM PATEL 8 Thurs 1500-1700 LH 111
394 2015CS10256 SARTHAK MISHRA 8 Thurs 1500-1700 LH 111
395 2015CS10262 SUYASH AGRAWAL 8 Thurs 1500-1700 LH 111
396 2015CS10268 YASH GAUTAM 8 Thurs 1500-1700 LH 111
397 2015ME20706 AAKASH VERMA 8 Thurs 1500-1700 LH 111
398 2015ME20707 AAKASH AHUJA 8 Thurs 1500-1700 LH 111
399 2015ME20708 ABHIJEET SAXENA 8 Thurs 1500-1700 LH 111
400 2015ME20710 AFSHAN ARIF 8 Thurs 1500-1700 LH 111
401 2015ME20713 AKSHAY KUMAR PANSARI 8 Thurs 1500-1700 LH 111
402 2015ME20714 AMAN NEGI 8 Thurs 1500-1700 LH 111
403 2015ME20715 AMIT JONWAL 8 Thurs 1500-1700 LH 111
404 2015ME20716 AMOGH GUPTA 8 Thurs 1500-1700 LH 111
405 2015ME20717 ANDIBOYINA SAI VAMSI 8 Thurs 1500-1700 LH 111
406 2015ME20718 ANIMESH JAISWAL 8 Thurs 1500-1700 LH 111
407 2015ME20719 ANIMESH JAIN 8 Thurs 1500-1700 LH 111
408 2015ME20722 ANTRIKSH MATHUR 8 Thurs 1500-1700 LH 111
409 2015ME20724 ARCHIT MATTA 8 Thurs 1500-1700 LH 111
410 2015ME20727 AYUSH KUMAR 8 Thurs 1500-1700 LH 111
411 2015ME20728 BHAGYAM CHOUDHARY 8 Thurs 1500-1700 LH 111
412 2015ME20732 HARSHIT HEMANI 8 Thurs 1500-1700 LH 111
413 2015ME20746 MOHIT DALAL 8 Thurs 1500-1700 LH 111
414 2015ME20748 NIKHIL BANSAL 8 Thurs 1500-1700 LH 111
415 2015ME20749 PIYUSH KUMAR 8 Thurs 1500-1700 LH 111
416 2015ME20752 PREETAM SURESH RATHOD 8 Thurs 1500-1700 LH 111
417 2015ME20759 SANJAY SINGH KHADDA 8 Thurs 1500-1700 LH 111
418 2015ME20760 SANKALP KATIYAR 8 Thurs 1500-1700 LH 111
419 2015ME20764 SHUBHAM VERMA 8 Thurs 1500-1700 LH 111
420 2015ME20765 SHUBHAM KUMAR 8 Thurs 1500-1700 LH 111
421 2015ME20769 TUSHAR SAHEBRAO KANHE 8 Thurs 1500-1700 LH 111
422 2015ME20771 YASH CHORDIA 8 Thurs 1500-1700 LH 111
423 2015ME20772 YASHASWI RATAN 8 Thurs 1500-1700 LH 111
424 2015MT10593 AYUSH GARG 8 Thurs 1500-1700 LH 111
425 2015MT10603 MAYANK GUPTA 8 Thurs 1500-1700 LH 111
426 2015TT10879 ATHARVA CHANDRA SINGH 8 Thurs 1500-1700 LH 111
427 2014BB10039 J SHANKAR 9 Fri 1300-1500 LH 111
428 2014CE10310 AMAN GUPTA 9 Fri 1300-1500 LH 111
429 2014CH10127 SAMARTH JAISWAL 9 Fri 1300-1500 LH 111
430 2014CS10259 TANTATI AVINASH 9 Fri 1300-1500 LH 111
431 2014CS50285 GULSHAN KUMAR JANGID 9 Fri 1300-1500 LH 111
432 2014EE10134 SHOBHIT JAIN 9 Fri 1300-1500 LH 111
433 2014EE10368 RAVINDRA KUMAR GUPTA 9 Fri 1300-1500 LH 111
434 2014EE10452 MANAS GUPTA 9 Fri 1300-1500 LH 111
435 2015CS10236 MANU MITRAAN K 9 Fri 1300-1500 LH 111
436 2015CS10242 PARTH SINGH 9 Fri 1300-1500 LH 111
437 2015CS50459 MAKKUNDA  SHARMA 9 Fri 1300-1500 LH 111
438 2015MT10375 SAURABH  PAL 9 Fri 1300-1500 LH 111
439 2015MT10560 HULLAS  JINDAL 9 Fri 1300-1500 LH 111
440 2015MT10595 CHARVI NAHAR 9 Fri 1300-1500 LH 111
441 2015MT10598 DRASHTI KHATSURIYA 9 Fri 1300-1500 LH 111
442 2015MT10602 MAJOR SINGH 9 Fri 1300-1500 LH 111
443 2015MT10605 PANKAJ 9 Fri 1300-1500 LH 111
444 2015MT60552 ANURAG UIKEY 9 Fri 1300-1500 LH 111
445 2015MT60554 AYUSH AGARWAL 9 Fri 1300-1500 LH 111
446 2015MT60555 AYUSH MALPANI 9 Fri 1300-1500 LH 111
447 2015MT60556 AYUSH SINGHAL 9 Fri 1300-1500 LH 111
448 2015MT60557 BHUVNESH KHANDELWAL 9 Fri 1300-1500 LH 111
449 2015MT60558 CHINMAY SINGH 9 Fri 1300-1500 LH 111
450 2015MT60559 DEEPENDRA KUMAR MEENA 9 Fri 1300-1500 LH 111
451 2015MT60561 MD TAUSIF ALAM 9 Fri 1300-1500 LH 114
452 2015MT60562 NIKHIL KUMAR AGRAWAL 9 Fri 1300-1500 LH 114
453 2015MT60563 PRANAV KUMAR 9 Fri 1300-1500 LH 114
454 2015MT60564 RANDHEER KUMAR GAUTAM 9 Fri 1300-1500 LH 114
455 2015MT60566 SAMARTH GULYANI 9 Fri 1300-1500 LH 114
456 2015MT60567 SIDDHARTH KHERA 9 Fri 1300-1500 LH 114
457 2015MT60568 TARUN GUPTA 9 Fri 1300-1500 LH 114
458 2015MT60569 UTSAV SEN 9 Fri 1300-1500 LH 114
459 2015PH10787 AMAN SINGAL 9 Fri 1300-1500 LH 114
460 2015PH10789 AMIT KUMAR 9 Fri 1300-1500 LH 114
461 2015PH10815 POORVA AGRAWAL 9 Fri 1300-1500 LH 114
462 2015PH10821 S BALAJI 9 Fri 1300-1500 LH 114
463 2015PH10839 YASHASWI GANGWAR 9 Fri 1300-1500 LH 114
464 2015TT10852 AASHI AGARWAL 9 Fri 1300-1500 LH 114
465 2015TT10877 ARSHDEEP SINGH GOINDI 9 Fri 1300-1500 LH 114
466 2015TT10900 JESSICA 9 Fri 1300-1500 LH 114
467 2015TT10907 MADHAV RANKA 9 Fri 1300-1500 LH 114
468 2015TT10909 MADHURI GURJAR 9 Fri 1300-1500 LH 114
469 2015TT10922 PRACHI GUPTA 9 Fri 1300-1500 LH 114
470 2015TT10943 SOPHIYA KHAN 9 Fri 1300-1500 LH 114
471 2014BB10024 AMIT KUMAR 10 Fri 1500-1700 LH 114
472 2014BB10036 GANJI UMESH CHANDAN 10 Fri 1500-1700 LH 114
473 2014BB50004 B M REVANTH 10 Fri 1500-1700 LH 114
474 2014CE10346 MANMOHAN SINGH DAGAR 10 Fri 1500-1700 LH 114
475 2014CE10352 NITISH 10 Fri 1500-1700 LH 114
476 2014CE10382 SHUBHAM AGRAWAL 10 Fri 1500-1700 LH 114
477 2015EE30112 MOULIK  CHORARIA 10 Fri 1500-1700 LH 114
478 2015EE30121 PRAKHAR  AGRAWAL 10 Fri 1500-1700 LH 114
479 2015EE30152 AKASH  GOYAL 10 Fri 1500-1700 LH 114
480 2015EE30501 AASHISH BHORSE 10 Fri 1500-1700 LH 114
481 2015EE30502 ABHAY SINGH 10 Fri 1500-1700 LH 114
482 2015EE30503 ABHISHEK VERMA 10 Fri 1500-1700 LH 114
483 2015EE30505 ADITI NEEMA 10 Fri 1500-1700 LH 114
484 2015EE30506 ADITYA SINGHAL 10 Fri 1500-1700 LH 114
485 2015EE30507 AISHWARY SRIVASTAVA 10 Fri 1500-1700 LH 114
486 2015EE30508 ARPIT BANKAWAT 10 Fri 1500-1700 LH 114
487 2015EE30509 AYUSH JOSHI 10 Fri 1500-1700 LH 114
488 2015EE30510 AYUSHI GARG 10 Fri 1500-1700 LH 114
489 2015EE30511 BIR SINGH 10 Fri 1500-1700 LH 114
490 2015EE30512 CHETAN KUMAR HARSOLIYA 10 Fri 1500-1700 LH 114
491 2015EE30513 DEEPANSHU RATHI 10 Fri 1500-1700 LH 114
492 2015EE30514 DIGVIJAI SINGH 10 Fri 1500-1700 LH 114
493 2015EE30515 DIVYA CHARAN 10 Fri 1500-1700 LH 114
494 2015EE30516 DIVYANSH SHUKLA 10 Fri 1500-1700 LH 114
495 2015EE30517 HARSH MAHESHWARI 10 Fri 1500-1700 LH 114
496 2015EE30518 HUNNEY KOTIYA 10 Fri 1500-1700 LH 114
497 2015EE30520 MAHENDRA MEENA 10 Fri 1500-1700 LH 114
498 2015EE30521 MOHAMMAD ALI KHAN 10 Fri 1500-1700 LH 114
499 2015EE30522 N AKASH 10 Fri 1500-1700 LH 114
500 2015EE30523 NIMISH MANGAL 10 Fri 1500-1700 LH 114
501 2015EE30524 NISHANT KUMAR SHARMA 10 Fri 1500-1700 LH 114
502 2015EE30525 PARIKSHIT PAYAL 10 Fri 1500-1700 LH 114
503 2015EE30526 PIYUSH BARUPAL 10 Fri 1500-1700 LH 114
504 2015EE30528 PRANAV VERMA 10 Fri 1500-1700 LH 114
505 2015EE30529 PRANJAL GUPTA 10 Fri 1500-1700 LH 114
506 2015EE30530 PRASHANT ANAND 10 Fri 1500-1700 LH 114
507 2015EE30531 RAKESH KUMAR 10 Fri 1500-1700 LH 114
508 2015EE30532 ROBIN BANSAL 10 Fri 1500-1700 LH 114
509 2015EE30533 SACHIN KUMAWAT 10 Fri 1500-1700 LH 114
510 2015EE30535 SAMARTH PATIL 10 Fri 1500-1700 LH 114
511 2015EE30536 SANGAM BHARTI 10 Fri 1500-1700 LH 114
512 2015EE30537 SARTHAK TYAGI 10 Fri 1500-1700 LH 114
513 2015EE30538 SATISH KUMAR GAURAV 10 Fri 1500-1700 LH 114
514 2015EE30539 SHIVAM SHEKHAR SINGH 10 Fri 1500-1700 LH 114
515 2015EE30540 SUGHOSH MODEM 10 Fri 1500-1700 LH 114
516 2015EE30542 TANMAY THAREJA 10 Fri 1500-1700 LH 114
517 2015EE30543 UTKARSH SAXENA 10 Fri 1500-1700 LH 114
518 2015EE30544 VIJAY SHANKER DUBEY 10 Fri 1500-1700 LH 114
519 2015EE30649 HARSH HEMANT  MALARA 10 Fri 1500-1700 LH 114
520 2015EE30750 PRADEEP  KUMAR 10 Fri 1500-1700 LH 114
521 2015EE30761 SANYAM  GUPTA 10 Fri 1500-1700 LH 114
522 2015EE30898 ISHU  JAIN 10 Fri 1500-1700 LH 114
523 2015MT10594 BARINDERPREET SINGH 10 Fri 1500-1700 LH 114
524 2015MT10597 DEVARAKONDA MANASA 10 Fri 1500-1700 LH 114
525 2015MT10604 MEGHNA CHOUDHARY 10 Fri 1500-1700 LH 114
526 2015MT10614 SHIVANGI AGRAWAL 10 Fri 1500-1700 LH 114
527 2015MT10615 SUMEET KHANDELWAL 10 Fri 1500-1700 LH 114
528 2015MT10617 VARTIKA BISHT 10 Fri 1500-1700 LH 114