Minor II Answer Keys: For any clarifications, please seek an appointment with Prof. B. Jayaram

Set A

S. No.

(Marks)

Question

Answer

1

(1)

Human genome is made up of

(a) coding, noncoding and extragenic DNA.

(b) genes for mRNA, tRNA, rRNA, micro RNA.

(c) genes for proteins, lipids and carbohydrates.

(d) genes for all types of RNA and telomeres. 

A

2

(1)

Tuberculosis is caused by a pathogen which belongs to

(a) eukaryotes.

(b) prokaryotes.

(c) archaea.

(d) fungi.

B

3

(1)

Membrane bilayer formation from monolayers is spontaneous in aqueous solutions and is facilitated primarily by 

(a) hydrogen bonds + hydrophobicity.

(b) van der Waals interactions + hydrophobicity.

(c) electrostatic + van der Waals interactions

(d) covalent bonds + hydrogen bonds

B

4

(1)

Simply stated, the difference between proteins bound in membranes and molecules in liquid crystals is that

(a) the former translate and rotate, the latter do not

(b) the former vibrate and the latter do not

(c) the former translate, the latter rotate

(d) the former rotate and the latter translate

C

5

(1)

Penicillin is not the best treatment for  viral infections because

(a) viruses developed b-lactamase to destroy penicillins.

(b) some humans develop allergic reaction to penicillin.

(c) viruses lack cellulose.

(d) viruses lack peptidoglycans.

D

6

(1)

Designing antibodies to fight/recognize antigens  is an example of

(a) protein folding problem.

(b) translation.

(c) inverse protein folding problem.

(d) replication.

C

7

(1)

Alternative splicing requires

(a) stem cells.

(b) ribosomes.

(c) meiosis.

(d) introns and exons.

D

8

(2)

Suppose you wish to remove 5’ ΰ 3’ directionality in DNA by making it symmetric. You could do this by creating an additional  covalent bond or by cleaving an existing covalent bond.

(a) create  a bond between C3’ and C5’ or cleave the bond between C4’ and O

 (b) create a bond between C2’ and C5’ or cleave the bond between C2’ and C3’

 (c) create a bond between C2’ and C4’ or cleave the bond between C3’ and C5’

(d) create a bond between C1’ and C3’ or cleave the bond between C1’ and C2’

B

9

(2)

How many ORFs are there in a piece of double helical DNA represented in the 5’ to 3’ direction as TTAATGCATGACTTAATATAA

(a)  0

(b)  1

(c)  2

(d)  3

D

10

(2)

How many matches are found in the best possible alignment of the following two sequences:  DLQDRYFQ & DNYYQALQ

(a) 2

(b) 3

(c) 4

(d) 5

B

11

(1)

What is reduced in Anfinsen’s experiments?

(a) Main chain carbonyl groups

(b) Side chain carbonyl groups

(c) S-S bonds between cysteines

(d) S-S bonds between methionines

C

12

(1)

Humans can digest starch easily but not cellulose, although both contain glucose because of 

(a) a (1-4) bonds in the former and b (1-4) bonds in the latter.

(b) a (1-6) bonds in the former and b (1-6) bonds in the latter.

(c) b (1-4) bonds in the former and a (1-4) bonds in the latter.

(d) D-glucose in the former and L-glucose in the latter.

A

13

(1 extra credit)

Insulin is an example of a

(a) fatty acid.

(b) lipid.

(c) carbohydrate.

(d) protein.

D

 Set B

S. No.

(Marks)

Question

Answer

1

(1)

Penicillin is not the best treatment for  viral infections because

(a) viruses developed b-lactamase to destroy penicillins.

(b) some humans develop allergic reaction to penicillin.

(c) viruses lack peptidoglycans.

(d) viruses lack cellulose.

C

2

(1)

Membrane bilayer formation from monolayers is spontaneous in aqueous solutions and is facilitated primarily by 

(a) hydrogen bonds + hydrophobicity.

(b) electrostatic + van der Waals interactions

(c) van der Waals interactions + hydrophobicity.

(d) covalent bonds + hydrogen bonds

C

3

(2)

How many ORFs are there in a piece of double helical DNA represented in the 5’ to 3’ direction as TTAATGCATGACTTAATATAA

(a)  3

(b)  2

(c)  1

(d)  0

A

4

(1)

Tuberculosis is caused by a pathogen which belongs to

(a) eukaryotes.

(b) archaea.

(c) prokaryotes.

(d) fungi.

C

5

(2)

How many matches are found in the best possible alignment of the following two sequences:  DLQDRYFQ & DNYYQALQ

(a) 2

(b) 3

(c) 4

(d) 5

B

6

(1)

Humans can digest starch easily but not cellulose, although both contain glucose because of 

(a) b (1-4) bonds in the former and a (1-4) bonds in the latter.

(b) a (1-4) bonds in the former and b (1-4) bonds in the latter.

(c) a (1-6) bonds in the former and b (1-6) bonds in the latter.

(d) D-glucose in the former and L-glucose in the latter.

B

7

(2)

Suppose you wish to remove 5’ ΰ 3’ directionality in DNA by making it symmetric. You could do this by creating an additional  covalent bond or by cleaving an existing covalent bond.

(a) create a bond between C2’ and C5’ or cleave the bond between C2’ and C3’

(b) create  a bond between C3’ and C5’ or cleave the bond between C4’ and O

(c) create a bond between C2’ and C4’ or cleave the bond between C3’ and C5’

(d) create a bond between C1’ and C3’ or cleave the bond between C1’ and C2’

A

8

(1)

Human genome is made up of

(a) genes for mRNA, tRNA, rRNA, micro RNA.

(b) genes for proteins, lipids and carbohydrates.

(c) genes for all types of RNA and telomeres. 

(d) coding, noncoding and extragenic DNA.

D

9

(1)

What is reduced in Anfinsen’s experiments?

 (a) S-S bonds between methionines

 (b) S-S bonds between cysteines

 (c) Main chain carbonyl groups

(d) Side chain carbonyl groups

B

10

(1)

Simply stated, the difference between proteins bound in membranes and molecules in liquid crystals is that

(a) the former translate and rotate, the latter do not

(b) the former vibrate and the latter do not

(c) the former translate, the latter rotate

(d) the former rotate and the latter translate

C

11

(1)

 Insulin is an example of a

(a) carbohydrate.

(b) protein.

(c) fatty acid.

(d) lipid.

B

12

(1)

Designing antibodies to fight/recognize antigens  is an example of

(a) translation.

(b) replication.

(c) protein folding problem.

(d) inverse protein folding problem.

D

13

(1 extra credit)

Alternative splicing requires

(a) stem cells.

(b) ribosomes.

(c) meiosis.

(d) introns and exons.

D

Set C

S. No.

(Marks)

Question

Answer

1

(1)

Designing antibodies to fight/recognize antigens  is an example of

(a) inverse protein folding problem.

(b) protein folding problem.

(c) translation.

(d) replication.

A

2

(1)

Human genome is made up of

(a) genes for all types of RNA and telomeres. 

(b) coding, noncoding and extragenic DNA.

(c) genes for mRNA, tRNA, rRNA, micro RNA.

(d) genes for proteins, lipids and carbohydrates.

B

3

(1)

Penicillin is not the best treatment for  viral infections because

(a) viruses lack peptidoglycans.

(b) viruses lack cellulose.

(c) viruses developed b-lactamase to destroy penicillins.

(d) some humans develop allergic reaction to penicillin.

A

4

(1)

Insulin is an example of a

(a) fatty acid.

(b) protein.

(c) lipid.

(d) carbohydrate.

B

5

(2)

Suppose you wish to remove 5’ ΰ 3’ directionality in DNA by making it symmetric. You could do this by creating an additional  covalent bond or by cleaving an existing covalent bond.

(a) create  a bond between C3’ and C5’ or cleave the bond between C4’ and O

 (b) create a bond between C2’ and C4’ or cleave the bond between C3’ and C5’

 (c) create a bond between C2’ and C5’ or cleave the bond between C2’ and C3’

 (d) create a bond between C1’ and C3’ or cleave the bond between C1’ and C2’

C

6

(1)

Alternative splicing requires

(a) stem cells.

(b) ribosomes.

(c) meiosis.

(d) introns and exons.

D

7

(1)

Membrane bilayer formation from monolayers is spontaneous in aqueous solutions and is facilitated primarily by 

(a) hydrogen bonds + hydrophobicity.

(b) electrostatic + van der Waals interactions.

 (c) van der Waals interactions + hydrophobicity.

(d) covalent bonds + hydrogen bonds.

C

8

(1)

Simply stated, the difference between proteins bound in membranes and molecules in liquid crystals is that

(a) the former translate, the latter rotate

(b) the former translate and rotate, the latter do not

(c) the former vibrate and the latter do not

(d) the former rotate and the latter translate

A

9

(2)

How many matches are found in the best possible alignment of the following two sequences:  DLQDRYFQ & DNYYQALQ

(a) 5

(b) 4

(c) 3

(d) 2

C

10

(1)

Tuberculosis is caused by a pathogen which belongs to

(a) prokaryotes.

(b) eukaryotes.

(c) archaea.

(d) fungi.

A

11

(2)

How many ORFs are there in a piece of double helical DNA represented in the 5’ to 3’ direction as TTAATGCATGACTTAATATAA

(a)  1

(b)  2

(c)  3

(d)  0

C

12

(1)

Humans can digest starch easily but not cellulose, although both contain glucose because of 

(a) a (1-4) bonds in the former and b (1-4) bonds in the latter.

(b) a (1-6) bonds in the former and b (1-6) bonds in the latter.

(c) b (1-4) bonds in the former and a (1-4) bonds in the latter.

(d) D-glucose in the former and L-glucose in the latter.

A

13

(1 extra credit)

What is reduced in Anfinsen’s experiments?

(a) Main chain carbonyl groups

(b) Side chain carbonyl groups

(c) S-S bonds between methionines

(d) S-S bonds between cysteines

D

Set D

S. No.

(Marks)

Question

Answer

1

(2)

How many ORFs are there in a piece of double helical DNA represented in the 5’ to 3’ direction as TTAATGCATGACTTAATATAA

(a)  0

(b)  3

(c)  2

(d)  1

B

2

(2)

Suppose you wish to remove 5’ ΰ 3’ directionality in DNA by making it symmetric. You could do this by creating an additional  covalent bond or by cleaving an existing covalent bond.

(a) create  a bond between C3’ and C5’ or cleave the bond between C4’ and O

(b) create a bond between C2’ and C4’ or cleave the bond between C3’ and C5’

(c) create a bond between C1’ and C3’ or cleave the bond between C1’ and C2’

(d) create a bond between C2’ and C5’ or cleave the bond between C2’ and C3’

D

3

(2)

How many matches are found in the best possible alignment of the following two sequences:  DLQDRYFQ & DNYYQALQ

(a) 4

(b) 5

(c) 2

(d) 3

D

4

(1)

Human genome is made up of

(a) genes for mRNA, tRNA, rRNA, micro RNA.

(b) genes for proteins, lipids and carbohydrates.

(c) coding, noncoding and extragenic DNA.

(d) genes for all types of RNA and telomeres. 

C

5

(1)

Designing antibodies to fight/recognize antigens  is an example of

(a) replication.

(b) translation.

(c) protein folding problem.

(d) inverse protein folding problem.

D

6

(1)

Penicillin is not the best treatment for  viral infections because

(a) viruses developed b-lactamase to destroy penicillins.

(b) some humans develop allergic reaction to penicillin.

(c) viruses lack peptidoglycans.

(d) viruses lack cellulose.

C

7

(1)

Tuberculosis is caused by a pathogen which belongs to

(a) archaea.

(b) fungi.

(c) eukaryotes.

(d) prokaryotes.

D

8

(1)

Membrane bilayer formation from monolayers is spontaneous in aqueous solutions and is facilitated primarily by 

(a) van der Waals interactions + hydrophobicity.

(b) hydrogen bonds + hydrophobicity.

(c) electrostatic + van der Waals interactions

(d) covalent bonds + hydrogen bonds

A

9

(1)

Alternative splicing requires

(a) stem cells.

(b) introns and exons.

(c) ribosomes.

(d) meiosis.

B

10

(1)

Humans can digest starch easily but not cellulose, although both contain glucose because of 

(a) D-glucose in the former and L-glucose in the latter.

(b) b (1-4) bonds in the former and a (1-4) bonds in the latter.

(c) a (1-4) bonds in the former and b (1-4) bonds in the latter.

(d) a (1-6) bonds in the former and b (1-6) bonds in the latter.

C

11

(1)

Simply stated, the difference between proteins bound in membranes and molecules in liquid crystals is that

(a) the former translate and rotate, the latter do not

(b) the former translate, the latter rotate

(c) the former vibrate and the latter do not

(d) the former rotate and the latter translate

B

12

(1)

 Insulin is an example of a

(a) protein.

(b) fatty acid.

(c) lipid.

(d) carbohydrate.

A

13

(1 extra credit)

What is reduced in Anfinsen’s experiments?

(a) Main chain carbonyl groups

(b) Side chain carbonyl groups

(c) S-S bonds between cysteines

(d) S-S bonds between methionines

C

Set E

S. No.

(Marks)

Question

Answer

1

(1)

Simply stated, the difference between proteins bound in membranes and molecules in liquid crystals is that

(a) the former translate and rotate, the latter do not

(b) the former vibrate and the latter do not

(c) the former rotate and the latter translate

(d) the former translate, the latter rotate

D

2

(1)

Alternative splicing requires

(a) ribosomes.

(b) meiosis.

(c) introns and exons.

(d) stem cells.

C

3

(1)

Human genome is made up of

(a) genes for mRNA, tRNA, rRNA, micro RNA.

(b) genes for proteins, lipids and carbohydrates.

(c) genes for all types of RNA and telomeres. 

(d) coding, noncoding and extragenic DNA.

D

4

(1)

Penicillin is not the best treatment for  viral infections because

(a) viruses lack cellulose.

(b) viruses lack peptidoglycans.

(c) viruses developed b-lactamase to destroy penicillins.

(d) some humans develop allergic reaction to penicillin.

B

5

(2)

How many ORFs are there in a piece of double helical DNA represented in the 5’ to 3’ direction as TTAATGCATGACTTAATATAA

(a)  0

(b)  1

(c)  2

(d)  3

D

6

(1)

What is reduced in Anfinsen’s experiments?

(a) Main chain carbonyl groups

(b) Side chain carbonyl groups

(c) S-S bonds between methionines

(d) S-S bonds between cysteines

D

7

(1)

Insulin is an example of a

(a) fatty acid.

(b) lipid.

(c) protein.

(d) carbohydrate.

C

8

(1)

Tuberculosis is caused by a pathogen which belongs to

(a) prokaryotes.

(b) eukaryotes.

(c) archaea.

(d) fungi.

A

9

(1)

Humans can digest starch easily but not cellulose, although both contain glucose because of 

(a) D-glucose in the former and L-glucose in the latter.

(b) b (1-4) bonds in the former and a (1-4) bonds in the latter.

(c) a (1-6) bonds in the former and b (1-6) bonds in the latter.

(d) a (1-4) bonds in the former and b (1-4) bonds in the latter.

D

10

(2)

Suppose you wish to remove 5’ ΰ 3’ directionality in DNA by making it symmetric. You could do this by creating an additional  covalent bond or by cleaving an existing covalent bond.

(a) create  a bond between C3’ and C5’ or cleave the bond between C4’ and O

(b) create a bond between C2’ and C4’ or cleave the bond between C3’ and C5’

(c) create a bond between C2’ and C5’ or cleave the bond between C2’ and C3’

(d) create a bond between C1’ and C3’ or cleave the bond between C1’ and C2’

C

11

(2)

How many matches are found in the best possible alignment of the following two sequences:  DLQDRYFQ & DNYYQALQ

(a) 3

(b) 5

(c) 2

(d) 4

A

12

(1)

Membrane bilayer formation from monolayers is spontaneous in aqueous solutions and is facilitated primarily by 

(a) electrostatic + van der Waals interactions

(b) covalent bonds + hydrogen bonds

(c) hydrogen bonds + hydrophobicity.

(d) van der Waals interactions + hydrophobicity.

D

13

(1 extra credit)

Designing antibodies to fight/recognize antigens  is an example of

(a) protein folding problem.

(b) inverse protein folding problem.

(c) translation.

(d) replication.

B

 

 

Seating arrangement for Minor II to be held on 9th October 2016 at 0800 hrs

   

The easiest way to locate anyone is to "Ctrl-F" the name or entry number

Students MUST sit in their allocated room ONLY. The answer sheet of anyone NOT sitting in their allocated room will NOT be graded.

Lab group assignment Examination Seating
S. No.  Entry Number  Student Name  Lab Gp Day Time (hrs) Minor II
1 2013CE10317 ADITYA YADAV 1 Mon 1300-1500 LH 121
2 2013CE10343 GOLLA NAGA CHAITANYA 1 Mon 1300-1500 LH 121
3 2013CE10348 JITENDER KUMAR 1 Mon 1300-1500 LH 121
4 2013CE10356 MAHENDRA SINGH 1 Mon 1300-1500 LH 121
5 2013CE10381 RAHUL MEENA 1 Mon 1300-1500 LH 121
6 2013CE10395 SUBHAM MEENA 1 Mon 1300-1500 LH 121
7 2013CE10420 YATHARTH SETH 1 Mon 1300-1500 LH 121
8 2013CH10112 SAGAR MITTAL 1 Mon 1300-1500 LH 121
9 2013CH70165 NIKHIL AGRAWAL 1 Mon 1300-1500 LH 121
10 2013CS10214 ASHISH KUMAR SINGH 1 Mon 1300-1500 LH 121
11 2013CS50277 ANAGH PRASAD 1 Mon 1300-1500 LH 121
12 2013EE10492 SAROJ KUMAR 1 Mon 1300-1500 LH 121
13 2013ME10641 AGRAWAL SHUBHAM RAJIV 1 Mon 1300-1500 LH 121
14 2013ME10688 LAVIT GOSWAMI 1 Mon 1300-1500 LH 121
15 2013ME10729 SUBHASISH DAS 1 Mon 1300-1500 LH 121
16 2013ME10736 VANKADOTH ESHWAR NAIK 1 Mon 1300-1500 LH 121
17 2013ME20807 YELLA RAVI TEJA 1 Mon 1300-1500 LH 121
18 2013MT60598 HIMANSHU GUPTA 1 Mon 1300-1500 LH 121
19 2013PH10822 AASTHA 1 Mon 1300-1500 LH 121
20 2013PH10829 AKSHAY PRASHANT HEGDE 1 Mon 1300-1500 LH 121
21 2013PH10834 ANKIP KUMAR 1 Mon 1300-1500 LH 121
22 2013PH10845 GAURAV RAWAT 1 Mon 1300-1500 LH 121
23 2013PH10856 NAVEEN YADAV 1 Mon 1300-1500 LH 121
24 2013PH10864 RISHABH MALLIK 1 Mon 1300-1500 LH 121
25 2013PH10869 SHAUNAK SANJAY THAKAR 1 Mon 1300-1500 LH 121
26 2013PH10881 VISHAL KUMAR 1 Mon 1300-1500 LH 121
27 2014CE10392 SUNIL KUMAR MEENA 1 Mon 1300-1500 LH 121
28 2014CE10395 SURAJ KUMAR 1 Mon 1300-1500 LH 121
29 2014CS10233 MAYANK RAJORIA 1 Mon 1300-1500 LH 121
30 2014CS10266 VIPPARTHY SAI ESVAR 1 Mon 1300-1500 LH 121
31 2014TT10169 JYOTI CHHANWAL 1 Mon 1300-1500 LH 121
32 2014TT10185 SHAILA KAROLE 1 Mon 1300-1500 LH 121
33 2014TT10856 ABHINAV SAHARAN 1 Mon 1300-1500 LH 121
34 2014TT10866 ANKIT 1 Mon 1300-1500 LH 121
35 2014TT10885 HIRA DURRANI 1 Mon 1300-1500 LH 121
36 2015CH10136 SUNAJE BHUSHAN 1 Mon 1300-1500 LH 121
37 2015CH70174 PARIDHI GUPTA 1 Mon 1300-1500 LH 121
38 2015CS10260 SHUBHAM SINGH TANWAR 1 Mon 1300-1500 LH 121
39 2015MT10608 PRANAV GOTHWAL 1 Mon 1300-1500 LH 121
40 2015PH10838 YARLAGADDA SANKARA DINESH 1 Mon 1300-1500 LH 121
41 2015TT10854 AYUSHI NARULA 1 Mon 1300-1500 LH 121
42 2015TT10856 ABHISHEK AGRAWAL 1 Mon 1300-1500 LH 121
43 2015TT10863 MINAAL DEMBLA 1 Mon 1300-1500 LH 121
44 2015TT10874 ANKUSH MANGAL 1 Mon 1300-1500 LH 121
45 2015TT10884 DAKSH CHANDRA BANSAL 1 Mon 1300-1500 LH 121
46 2015TT10887 DEEPALI VERMA 1 Mon 1300-1500 LH 121
47 2015TT10892 DHRUV GUPTA 1 Mon 1300-1500 LH 121
48 2015TT10917 NAVREET KAUR 1 Mon 1300-1500 LH 121
49 2015TT10921 PIYUSH GUPTA 1 Mon 1300-1500 LH 121
50 2015TT10932 REEWA GAUTAM 1 Mon 1300-1500 LH 121
51 2015TT10937 SHEETAL SHRAISTH 1 Mon 1300-1500 LH 121
52 2013TT10891 AASHNA MEHRA 2 Mon 1500-1700 LH 121
53 2013TT10912 AYUSH JAIN 2 Mon 1500-1700 LH 121
54 2013TT10938 KARISHMA DHAKAD 2 Mon 1500-1700 LH 121
55 2013TT10956 RAVI SONKRIYA 2 Mon 1500-1700 LH 121
56 2013TT10962 SAUBHAGYA SONAL 2 Mon 1500-1700 LH 121
57 2013TT10974 UJJAWAL MALIK 2 Mon 1500-1700 LH 121
58 2013TT10979 VISHAL 2 Mon 1500-1700 LH 121
59 2014BB10037 GULSHAN VERMA 2 Mon 1500-1700 LH 121
60 2014CE10308 AKHILESH KUMAR 2 Mon 1500-1700 LH 121
61 2014CE10309 ALOK KUMAR 2 Mon 1500-1700 LH 121
62 2014CE10311 AMAN GUPTA 2 Mon 1500-1700 LH 121
63 2014CE10317 ANSHU RANJAN 2 Mon 1500-1700 LH 121
64 2014CE10320 ANUBHAV SHARMA 2 Mon 1500-1700 LH 121
65 2014CE10329 AYUSH VARSHNEY 2 Mon 1500-1700 LH 121
66 2014CE10332 BRAJ KANT 2 Mon 1500-1700 LH 121
67 2014CE10333 BRIJVASI MEENA 2 Mon 1500-1700 LH 121
68 2014CE10336 DHARAM SINGH MEENA 2 Mon 1500-1700 LH 121
69 2014CE10347 MOHIT PAHUJA 2 Mon 1500-1700 LH 121
70 2014CE10356 PREMANJAN SUNA 2 Mon 1500-1700 LH 121
71 2014CE10358 RAGHAV RATTAN 2 Mon 1500-1700 LH 121
72 2014CE10370 RIYA AGARWAL 2 Mon 1500-1700 LH 121
73 2014CE10372 SAMARTH GOYAL 2 Mon 1500-1700 LH 121
74 2014CE10373 SAMEER TRIPATHI 2 Mon 1500-1700 LH 121
75 2014CE10374 SANDEEP 2 Mon 1500-1700 LH 121
76 2014CE10376 SAURAV SUMAN 2 Mon 1500-1700 LH 121
77 2014CE10378 SHEIK MOHAMMED YAHYA S 2 Mon 1500-1700 LH 121
78 2014CE10387 SIDDHARTH K MISRA 2 Mon 1500-1700 LH 121
79 2014CE10390 SUMIT SHARMA 2 Mon 1500-1700 LH 121
80 2014CE10391 SUMIT YADAV 2 Mon 1500-1700 LH 121
81 2014CE10393 SUNIL YADAV 2 Mon 1500-1700 LH 121
82 2014CE10398 TUSHAR GOYAL 2 Mon 1500-1700 LH 121
83 2014CE10405 YUVRAJ SURYAVANSHI 2 Mon 1500-1700 LH 121
84 2014CE10851 A ABHISHEK ARUNACHALAM 2 Mon 1500-1700 LH 121
85 2015BB10021 ABHINAV ARORA 2 Mon 1500-1700 LH 121
86 2015BB10023 ADHHAYAN 2 Mon 1500-1700 LH 121
87 2015BB10025 AKASHI NEGI 2 Mon 1500-1700 LH 121
88 2015BB10027 ANJALI CHOURDIA 2 Mon 1500-1700 LH 121
89 2015BB10029 ARNAV KARAN 2 Mon 1500-1700 LH 121
90 2015BB10033 EASH SHARMA 2 Mon 1500-1700 LH 121
91 2015BB10037 HIMANSHU SINGH SAGAR 2 Mon 1500-1700 LH 121
92 2015BB10041 KUMAR KOMALESHWARI RANI NARESH 2 Mon 1500-1700 LH 121
93 2015BB10043 MALLIKA SINGLA 2 Mon 1500-1700 LH 121
94 2015BB10047 PALLAVI MISRA 2 Mon 1500-1700 LH 121
95 2015BB10051 PRINCE AGRAWAL 2 Mon 1500-1700 LH 121
96 2015BB10055 RAKESH KUMAR SUKHANI 2 Mon 1500-1700 LH 121
97 2015BB10059 SHIVAM SAHU 2 Mon 1500-1700 LH 121
98 2015BB10061 SUSHANT KHARE 2 Mon 1500-1700 LH 121
99 2015BB10065 VIKRANT YADAV 2 Mon 1500-1700 LH 121
100 2015BB50001 A R SHUBHAM 2 Mon 1500-1700 LH 121
101 2015BB50003 BHARTI MEENA 2 Mon 1500-1700 LH 121
102 2015BB50005 INDHANA DIVYA JAYASREE 2 Mon 1500-1700 LH 121
103 2015BB50007 KANCHARANA PREETI RAJ 2 Mon 1500-1700 LH 121
104 2015BB50009 DHAVAL RAKESH NARWANI 2 Mon 1500-1700 LH 121
105 2015BB50011 PATNANA MOUNICA 2 Mon 1500-1700 LH 121
106 2015BB50013 SASHI KALAN 2 Mon 1500-1700 LH 121
107 2015BB50015 YUGESH VERMA 2 Mon 1500-1700 LH 121
108 2015CS10291 SANGNIE  BHARDWAJ 2 Mon 1500-1700 LH 121
109 2015ME20726 AYUSH JINDAL 2 Mon 1500-1700 LH 121
110 2015PH10822 SAGARE CHETAN BASAWARAJ 2 Mon 1500-1700 LH 121
111 2013CH10074 ANTRIKSH JOHRI 3 Tues 1300-1500 LH 121
112 2013CH10115 SARTHAK SAINI 3 Tues 1300-1500 LH 121
113 2013CH10119 SAURABH DOGRA 3 Tues 1300-1500 LH 121
114 2013CH70170 ROHAN KHANDELWAL 3 Tues 1300-1500 LH 121
115 2013PH10843 DASHMEET SINGH ISSER 3 Tues 1300-1500 LH 121
116 2014CE10301 AARUSH GUPTA 3 Tues 1300-1500 LH 121
117 2014CE10304 ABHISHEK PRATAP SINGH 3 Tues 1300-1500 LH 121
118 2014CE10307 AKHIL GOYAL 3 Tues 1300-1500 LH 121
119 2014CE10312 AMOL SINGH 3 Tues 1300-1500 LH 121
120 2014CE10315 ANKIT KUMAR 3 Tues 1300-1500 LH 121
121 2014CE10318 ANSHUL PAREEK 3 Tues 1300-1500 LH 121
122 2014CE10322 ARPIT GUNAWAT 3 Tues 1300-1500 LH 121
123 2014CE10323 ARUSH VERMA 3 Tues 1300-1500 LH 121
124 2014CE10324 ARVIND KUMAR 3 Tues 1300-1500 LH 121
125 2014CE10327 ATISH SAURAV 3 Tues 1300-1500 LH 121
126 2014CE10330 B CHANDRAKANTH 3 Tues 1300-1500 LH 121
127 2014CE10331 BHARAT KUMAR SHARMA 3 Tues 1300-1500 LH 121
128 2014CE10335 DEVESH SHUKLA 3 Tues 1300-1500 LH 121
129 2014CE10337 DHRUV SOOD 3 Tues 1300-1500 LH 121
130 2014CE10340 HARSHA TIWARI 3 Tues 1300-1500 LH 121
131 2014CE10344 KINRA MOHIT LALIT 3 Tues 1300-1500 LH 121
132 2014CE10350 NIMMA SANTOSH 3 Tues 1300-1500 LH 121
133 2014CE10351 NITIN KUMAR 3 Tues 1300-1500 LH 121
134 2014CE10353 PAWAN JOON 3 Tues 1300-1500 LH 121
135 2014CE10359 RAJEEV KUMAR 3 Tues 1300-1500 LH 121
136 2014CE10360 RAJESH NARRAVULA 3 Tues 1300-1500 LH 121
137 2014CE10361 RAKESH CHOUDHARY 3 Tues 1300-1500 LH 121
138 2014CE10364 RAVI KUMAR MAHAWAR 3 Tues 1300-1500 LH 121
139 2014CE10366 RAVI KUMAR MITTAL 3 Tues 1300-1500 LH 121
140 2014CE10375 SANYAM GUPTA 3 Tues 1300-1500 LH 121
141 2014CE10379 SHIVAM KOUSHAL 3 Tues 1300-1500 LH 121
142 2014CE10381 SHIVAM RANA 3 Tues 1300-1500 LH 121
143 2014CE10384 SHUBHAM CHAUDHARY 3 Tues 1300-1500 LH 121
144 2014CE10388 SOURABH MHASKI 3 Tues 1300-1500 LH 121
145 2014CE10400 VAIBHAV MEHTA 3 Tues 1300-1500 LH 121
146 2014CH10112 NAMAN AGRAWAL 3 Tues 1300-1500 LH 121
147 2014EE10470 PRASHANTH M 3 Tues 1300-1500 LH 121
148 2014TT10881 DIVYAM GUPTA 3 Tues 1300-1500 LH 121
149 2015BB10038 MIHIR CHANDRASHEKHAR JAIN 3 Tues 1300-1500 LH 121
150 2015BB10040 JEETU SINGH 3 Tues 1300-1500 LH 121
151 2015BB10042 LAMGHARE ADITYA RAJU 3 Tues 1300-1500 LH 325
152 2015BB10046 PAHADE ASMITA KAMALKUMAR 3 Tues 1300-1500 LH 325
153 2015BB10048 PIYUSH KUMAR 3 Tues 1300-1500 LH 325
154 2015BB10050 PRAJJWAL SIHAG 3 Tues 1300-1500 LH 325
155 2015BB10052 PUNEET LAGOO 3 Tues 1300-1500 LH 325
156 2015BB10054 RAJ KUMAR RAVIDAS 3 Tues 1300-1500 LH 325
157 2015BB10056 ROSHINEE P 3 Tues 1300-1500 LH 325
158 2015CS50277 AMOL MUKESH BAMBODE 3 Tues 1300-1500 LH 325
159 2014CH10077 AJAY PRAKASH SRIVATSA 4 Tues 1500-1700 LH 325
160 2014CH10090 ASHWIN BHOLA 4 Tues 1500-1700 LH 325
161 2014CH10097 GANVIR PRANIT KIRAN 4 Tues 1500-1700 LH 325
162 2014CH10121 RATNESH NATH 4 Tues 1500-1700 LH 325
163 2014CH10128 SANKALP KUMAR MAURYA 4 Tues 1500-1700 LH 325
164 2014CH10145 VIKAS MEENA 4 Tues 1500-1700 LH 325
165 2014CH70194 UDIT S BEHL 4 Tues 1500-1700 LH 325
166 2014CS10202 ABHIJEET ANAND 4 Tues 1500-1700 LH 325
167 2014CS10203 ABHILASH RAMTEKE 4 Tues 1500-1700 LH 325
168 2014CS10204 ABHISHEK SANGWAN 4 Tues 1500-1700 LH 325
169 2014CS10207 AGRAWAL PRAKHAR YOGESH 4 Tues 1500-1700 LH 325
170 2014CS10211 ARKAPRAVA SAHA 4 Tues 1500-1700 LH 325
171 2014CS10213 AYUSHYA RAJ 4 Tues 1500-1700 LH 325
172 2014CS10218 DIVYANSH 4 Tues 1500-1700 LH 325
173 2014CS10219 GANGASANI SAI SRIMANTH 4 Tues 1500-1700 LH 325
174 2014CS10220 GURTEJ SINGH SOHI 4 Tues 1500-1700 LH 325
175 2014CS10221 HARSH ARYA 4 Tues 1500-1700 LH 325
176 2014CS10222 HARSHIL R MEENA 4 Tues 1500-1700 LH 325
177 2014CS10225 JATIN YADAV 4 Tues 1500-1700 LH 325
178 2014CS10229 KISHALAY RAJ 4 Tues 1500-1700 LH 325
179 2014CS10230 KRITARTH 4 Tues 1500-1700 LH 325
180 2014CS10232 KUSHAGRA MADAN 4 Tues 1500-1700 LH 325
181 2014CS10237 MOHIT BAJAJ 4 Tues 1500-1700 LH 325
182 2014CS10243 NETHALA BILVA TEJA BALA TATAJI RAO 4 Tues 1500-1700 LH 325
183 2014CS10244 NITIN RATHOR 4 Tues 1500-1700 LH 325
184 2014CS10246 PRAGNESH JOGADIYA 4 Tues 1500-1700 LH 325
185 2014CS10248 RAHUL KUMAR 4 Tues 1500-1700 LH 325
186 2014CS10255 SHUBH CHAURASIA 4 Tues 1500-1700 LH 325
187 2014CS10256 SHUBHAM RATHI 4 Tues 1500-1700 LH 325
188 2014CS10258 SOURAV DAS 4 Tues 1500-1700 LH 325
189 2014CS10260 TUHINANKSU DAS 4 Tues 1500-1700 LH 325
190 2014CS10261 UJJWAL KUMAR 4 Tues 1500-1700 LH 325
191 2014CS10264 VIKAS CHOUHAN 4 Tues 1500-1700 LH 325
192 2014CS10267 VISHNU BHALAKI 4 Tues 1500-1700 LH 325
193 2014CS10268 WAGHMARE SAURABH MILIND 4 Tues 1500-1700 LH 325
194 2014CS10290 PRAKHAR GUPTA 4 Tues 1500-1700 LH 325
195 2014CS50286 KARTAR SINGH 4 Tues 1500-1700 LH 325
196 2014CS50291 PUNIT TIGGA 4 Tues 1500-1700 LH 325
197 2014CS50294 SHOVAN PAUL 4 Tues 1500-1700 LH 325
198 2014CS50736 KAPIL KUMAR 4 Tues 1500-1700 LH 325
199 2015BB10022 ABHISHEK KUMAR SAHU 4 Tues 1500-1700 LH 325
200 2015BB10024 AISHVI JAIN 4 Tues 1500-1700 LH 325
201 2015BB10026 AMRITANSHU 4 Tues 1500-1700 LH 325
202 2015BB10028 ANKIT KUMRAWAT 4 Tues 1500-1700 LH 325
203 2015BB10030 ASHWIN GARG 4 Tues 1500-1700 LH 325
204 2015BB10032 DEEPESH NATHANI 4 Tues 1500-1700 LH 325
205 2015BB10034 GUDDU KUMAR 4 Tues 1500-1700 LH 325
206 2015BB10036 HIMANI GAUTAM KAMBALE 4 Tues 1500-1700 LH 325
207 2015BB10058 SATYAM NATHANI 4 Tues 1500-1700 LH 325
208 2015BB10060 SHRADHA SAINI 4 Tues 1500-1700 LH 325
209 2015ME20720 ANSH JAIN 4 Tues 1500-1700 LH 325
210 2015PH10790 AMIT KUMAR 4 Tues 1500-1700 LH 325
211 2015PH10796 CHEENA AGARWAL 4 Tues 1500-1700 LH 325
212 2015PH10812 NAYANTARA MUDUR 4 Tues 1500-1700 LH 325
213 2015PH10840 YASHTI AGRAWAL 4 Tues 1500-1700 LH 325
214 2013CH70146 AKASH SINGH 5 Wed 1300-1500 LH 325
215 2013CH70162 MAYANK DEEP BANSOD 5 Wed 1300-1500 LH 325
216 2013ME10741 YANDA PRAVEEN KUMAR 5 Wed 1300-1500 LH 325
217 2015CH10002 ADITI  MAHAJAN 5 Wed 1300-1500 LH 325
218 2015CH10071 ABHAY KUMAR SAROTHIA 5 Wed 1300-1500 LH 325
219 2015CH10073 ABHIPRAI MISRA 5 Wed 1300-1500 LH 325
220 2015CH10075 ABHISHEK SINGH 5 Wed 1300-1500 LH 325
221 2015CH10076 ABHISHREE ARORA 5 Wed 1300-1500 LH 325
222 2015CH10077 ADARSH SAINI 5 Wed 1300-1500 LH 325
223 2015CH10081 AMAN VERMA 5 Wed 1300-1500 LH 325
224 2015CH10082 AMITESH RATHI 5 Wed 1300-1500 LH 325
225 2015CH10083 ANIKET KUMAR 5 Wed 1300-1500 LH 325
226 2015CH10084 ANISH KUJUR 5 Wed 1300-1500 LH 325
227 2015CH10085 ANSHIL CHANDRA 5 Wed 1300-1500 LH 325
228 2015CH10086 ANURAG DEEDWANIYA 5 Wed 1300-1500 LH 325
229 2015CH10087 ARNAB MANDAL 5 Wed 1300-1500 LH 325
230 2015CH10089 ARYAMAN BANSAL 5 Wed 1300-1500 LH 325
231 2015CH10090 ATUL YADAV 5 Wed 1300-1500 LH 325
232 2015CH10091 BANDISH PARIKH 5 Wed 1300-1500 LH 325
233 2015CH10092 BHAVYA DHURIA 5 Wed 1300-1500 LH 325
234 2015CH10093 CHANCHAL MEENA 5 Wed 1300-1500 LH 325
235 2015CH10094 DEVANDRA GODARA 5 Wed 1300-1500 LH 325
236 2015CH10095 DHANANJAY MEENA 5 Wed 1300-1500 LH 325
237 2015CH10096 DHARAM RAJ MEENA 5 Wed 1300-1500 LH 325
238 2015CH10097 DIKSHANT MAKHIJA 5 Wed 1300-1500 LH 325
239 2015CH10098 DIVYA SINGH 5 Wed 1300-1500 LH 325
240 2015CH10099 DIVYANK MITTAL 5 Wed 1300-1500 LH 325
241 2015CH10100 HARNEET SINGH 5 Wed 1300-1500 LH 325
242 2015CH10103 JATIN SHARMA 5 Wed 1300-1500 LH 325
243 2015CH10104 KRITIKA SHARMA 5 Wed 1300-1500 LH 325
244 2015CH10105 KSHITIJ GOEL 5 Wed 1300-1500 LH 325
245 2015CH10106 KUMAR UTKARSH 5 Wed 1300-1500 LH 325
246 2015CH10107 LALIT SWAMI 5 Wed 1300-1500 LH 325
247 2015CH10109 MILIND DHANRAJ ZODE 5 Wed 1300-1500 LH 325
248 2015CH10116 NIKHIL KUMAR MEENA 5 Wed 1300-1500 LH 325
249 2015CH10117 NISHA SINGH 5 Wed 1300-1500 LH 325
250 2015CH10119 PARTH RAJORA 5 Wed 1300-1500 LH 325
251 2015CH10122 PULKIT SRIVASTAVA 5 Wed 1300-1500 LH 325
252 2015CH10123 PULKIT LANGAN 5 Wed 1300-1500 LH 325
253 2015CH10124 RITIK CHAWLA 5 Wed 1300-1500 LH 325
254 2015CH10125 SAKSHAM GUPTA 5 Wed 1300-1500 LH 325
255 2015CH10126 SHALINI GUPTA 5 Wed 1300-1500 LH 325
256 2015CH10127 SHASHANK GUPTA 5 Wed 1300-1500 LH 325
257 2015CH10130 SHUBHAM 5 Wed 1300-1500 LH 325
258 2015CH10131 SIDDHARTH SACHAN 5 Wed 1300-1500 LH 325
259 2015CH10132 SIMRAN MALIK 5 Wed 1300-1500 LH 325
260 2015CH10133 SMARTH VEER SIDANA 5 Wed 1300-1500 LH 325
261 2015CH10134 SOUMYA PRAKASH BEHERA 5 Wed 1300-1500 LH 325
262 2015CH10135 SUBHANKAR DASH 5 Wed 1300-1500 LH 325
263 2015CH10137 SUNINT SINGH KHURANA 5 Wed 1300-1500 LH 325
264 2015CH10138 SUSHREE JAGRITI SAHOO 5 Wed 1300-1500 LH 325
265 2015CH10139 UDAIVEER 5 Wed 1300-1500 LH 325
266 2015CH10140 UJJWAL NARWAL 5 Wed 1300-1500 LH 325
267 2015CH10144 VINAYAK GUPTA 5 Wed 1300-1500 LH 325
268 2015CH10145 VISHESH GOYAL 5 Wed 1300-1500 LH 325
269 2015ME20711 AJAYENDRA SINGH 5 Wed 1300-1500 LH 325
270 2013CH70163 NAKUL BAHMANIA 6 Wed 1500-1700 LH 325
271 2013ME10653 BANAVATH ROOPESH 6 Wed 1500-1700 LH 325
272 2013ME10656 CHEEKATI RAKESH BABU 6 Wed 1500-1700 LH 325
273 2013ME20771 BACHANTI KRISHNA 6 Wed 1500-1700 LH 325
274 2014CH70184